Name: loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens
Uploaded: 2015-02-20T14:00:00
Duration: 6 min 57 s
Description: Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. Skabelon Forberedelse BEMÆRK: genomisk DNA template mistænkes for at indeholde DNA afledt fra en af de syv Eimeria arter, som inficerer kyllinger kan anvendes som template for LAMP-baserede Eimeria artsidentifikation. Tarmvævet prøver til felt diagnostisk analyse skal indsamles under rutinemæssig post mortem, som beskrevet her. <ol><li> Vælg sektion (eller sektioner) af tarmen, der skal testes. Se Tabel 1 for en vejledning til prøve valg af lokalitet og Eimeria arter mest sandsynlige til at være til stede 18 og figur 1 for artsspecifikke vifte af distribution og placering af prøveudtagningssteder. BEMÆRK: Dette er af afgørende betydning, da Eimeria er især vært stedspecifikke. Hver art, der inficerer kyllinger er defineret af den intestinale region, at det er rettet mod 19. Beslutningen kan være påvirket af tidligere erfaringer af gården, interesse i en eller more specifikke Eimeria arter eller andre diagnostiske indikatorer 6. </li><li> Forbrugsafgifter 5 cm eller længere længder af tarmstykke (r) udvalgt til at teste for Eimeria sterile saks eller en skalpel. Eventuelt opbevare prøver til efterfølgende analyse i et fiksativ, såsom for eksempel i RNAlater 18 eller 95% ethanol. BEMÆRK: Hvis lagring i ethanol prøven skal vaskes grundigt i sterilt tris-ethylendiamintetraeddikesyre (TE) buffer før brug. </li><li> Prøven åben på langs, fjerne de fleste tarmindhold (hvis til stede) og skrabe cellerne fra slimhindelaget fri ved hjælp af enten kanten af ​​en steril objektglas eller en ethanol / flamme steriliseret saks klinge. Eventuelt til en samleprøve omfatter celler fra alle fire artsspecifikke tarm steder i et enkelt rør. </li><li> Sæt skrabet materiale i en steril 1,5 ml skruelåg mikrocentrifugerør indeholdende 100 pi sterilt TE-buffer med 10% (w / v) Chelex 100 harpiks. </li><li> Ryst hver prøve kraftigt i 1 min. Sørg for at skrue top er helt lukket, og derefter inkuberes i et kogende vandbad i 10 min. </li><li> Efter kogning tillade hver prøve til at afkøle ved stuetemperatur i 1-2 minutter. </li><li> Centrifuger hver prøve under anvendelse af en mikrocentrifuge ved tophastighed (f.eks ~ 10.000 xg) i 1 min. </li><li> Saml 2 pi af den resulterende supernatant til at være skabelon i hver lygte assay, der skal iværksættes. Eventuelt pool mere end én intestinal sted i et enkelt rør for at tilvejebringe en multi-site assay. </li></ol> 2. Eimeria LAMP Primer Preparation (Pre-assay) <ol><li> Forbered Eimeria LAMP primer lagre tilstrækkelige til 100 analyser: <ol><li> Rekonstituer hvert frysetørret Eimeria LAMP primer ved at tilføje vand af molekylærbiologisk kvalitet til en koncentration på 100 uM (som specificeret af fabrikanten). Hvis ikke angivet, beregne mængden af ​​vand af molekylærbiologisk kvalitet kræves using fysiske og molekylvægten af ​​hver primer. </li><li> Pipette 60 pi vand af molekylærbiologisk kvalitet i et separat 0,5 ml flip-top mikrocentrifugerør for hver Eimeria art, der skal analyseres. </li><li> Tilføj primere FIP, BIP, F3, B3, LF og LB specifikke target Eimeria arter til vandet ved hjælp af de i tabel 2 viste bind, hvilket skaber en række af syv artsspecifikke primerblandinger. </li><li> Kort vortex blande primer løsning, så puls mikrofuge og fryse indtil anvendelse. </li></ol></li><li> Forbered en LAMP reaktion mastermiksens for hver Eimeria art, der skal analyseres. Multiplicer de i tabel 3 viste mængder ved antallet af prøver og tilsæt tre til en positiv kontrol, negativ kontrol og pipettering reservedele. Tilsæt til en 0,5 eller 1,5 ml flip-top mikrocentrifugerør. </li></ol> 3. Eimeria LAMP Assay <ol><li> Pipette 23 pi Eimeria artsspecifikke Bst DNA-polymerase / LAMP MasterMix i en 0.5 ml mikrocentrifugerør. </li><li> Tilsæt 2 pi DNA template (fremstillet i afsnit 1), træffes en endelig reaktion volumen på 25 pi. </li><li> Tilsæt 2 pi Eimeria artsspecifik genomisk DNA til en reaktion (positiv kontrol). Tilsæt 2 pi vand af molekylærbiologisk kvalitet reaktion (negativ kontrol). BEMÆRK: Hvis artsspecifik genomisk DNA ikke er tilgængelig en tidligere positiv LAMP eller standard PCR-produkt kan anvendes i stedet. </li><li> Inkuber i et vandbad eller varmeblok ved 62 ° C i 30 min. Eventuelt de-aktivere Bst DNA-polymerase ved opvarmning til 80 ° C i 10 minutter, hvis reaktionen ikke vil aflæses straks. </li></ol> 4. LAMP Assay Udlæsning <ol><li> Ved afslutningen af ​​inkubationen vurdere farven af ​​hver reaktion ved øjet under indendørs lys. Negative resultater synes rosa til violet farve, positive resultater vises himmelblå 20. </li><li> Eventuelt bekræfte LAMP analyseresultatet i en laboratrisk ved at blande 5 pi LAMP reaktionsprodukt med 1 pi DNA gel loading buffer til agarosegelelektroforese under anvendelse af en 2% agarosegel i 1 x Tris / borat / EDTA (TBE) buffer, præ-farvet under anvendelse af en nucleinsyrefarve (5 pi per 50 ml agarose). Tilsæt 5 pi af en 1 kb molekylstørrelse DNA-stige til bane 1 af gelen til at tillade beregning fragment størrelse. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

Global kylling produktion er tidoblet i løbet af de sidste 50 år med udviklingslandene hosting næsten fire gange udvidelsen vidne i den udviklede verden <a href="http://www.faostat.org">(www.faostat.org)</a> . Da relevansen af ​​kylling produktion til fødevaresikkerheden på verdensplan er vokset så også har profilen af ​​patogener, som kan forårsage alvorlig sygdom hos kyllinger. Et godt eksempel er de Eimeria arter, allestedsnærværende protozoparasitter der kan forårsage den enteriske sygdom coccidiose 1. Hvor kyllinger opdrættes en eller flere Eimeria-arter er sandsynligvis være fælles 2-4. I den udviklede verden Eimeria er primært styret af kemoprofylakse, beskæftiger shuttle eller rotation programmer til at minimere konsekvenserne af resistens 5. Levende vacciner bruges også i systemer, hvor fugl værdi er tilstrækkelig til at retfærdiggøre udgifterne (f.eks avlsdyr, lag og nogle slagtekyllinger 5). Som result af disse foranstaltninger klinisk coccidiose ofte velkontrollerede, selvom subklinisk infektion er almindelig 5. I udviklingslandene vaccination er sjælden og narkotika ansøgning ofte mindre godt informeret. Som en konsekvens subklinisk og klinisk coccidiose er mere almindelig og udøver en betydelig økonomisk virkning 3. Diagnose af eimerian infektion har traditionelt påberåbt læsion scorer post mortem, selvom selv de forfattere mest udbredte pointsystem kommenterede, at for nogle arter &quot;er det tvivlsomt, om en sådan procedure bør forsøges i enhver men moderat svære infektioner&quot; 6. Supplerende dokumentation kan samles ved en mikroskopisk påvisning af den miljømæssigt resistente oocyst livscyklus etape i gødningsprøver eller kuld prøver, selv om overlappende morfologi kan forvirre alle, men eksperten 6,7. Molekylære alternativer ved hjælp af polymerasekædereaktion (PCR), tilfældig amplification af polymorfe DNA PCR (RAPD-PCR) og kvantitative PCR-teknologier har været tilgængelige i op til 20 år 8-10, men til dato de har undladt at blive populær. Relativ regning og kravet om specialiseret laboratorieudstyr eller forarbejdning har begrænset deres optagelse på trods af ofte subjektive og teknisk krævende karakter ældre pathology- og mikroskopi tilgange 10,11. Sådanne begrænsninger kan være overdrevet i mange af de fattigere regioner i verden, såsom Sydøstasien, hvor virkningen af coccidiose på fattigdommen kan være forholdsmæssigt større 12. Som svar er der et klart behov for nye ligetil og følsom, men omkostningseffektive, Eimeria Artsspecifikke diagnostiske analyser. Loop-medieret isotermisk amplifikation (lampe) er en nem at fremstille DNA-polymerase-driven teknik, der er i stand til at amplificere store mængder DNA. Vigtigst bruger LAMP et Bst DNA polymeraSE stedet for Taq-DNA-polymerase er almindeligt anvendt i PCR, hvilket letter DNA-amplifikation ved en enkelt konstant temperatur uden kravet om termisk cykling 13,14. Lampen kan gøres til genstand for ansøgning i selv de mest rudimentære laboratorium eller i felten. Karakteriseret ved relativ resistens over for mange PCR-inhibitorer, høj følsomhed og specificitet, er blevet udviklet LAMP assays for en bred vifte af patogener, herunder infektiøs bursal disease virus, Clostridium perfringens og Cryptosporidium 15-17. Som svar på efterspørgslen efter nye omkostningseffektive Eimeria Artsspecifikke diagnostik et panel af LAMP assays er specifikke for hver af de syv Eimeria arter, der inficerer kyllinger er udviklet 18. Ansøgninger om de nye analyser omfatte overvågning parasit forekomst, af særlig værdi i betragtning af den sammenslutning af arter som Eimeria maxima eller Eimeria necatrix med dårlige økonomiske performance 3,4. Andre anvendelsesområder omfatter vurdering af effektiviteten af en bedrifts anticoccidial strategi, diagnosticering af subklinisk infektion eller klinisk sygdom og evaluering af risiko, som Eimeria til en gård.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

Assay validering Under validering hver Eimeria artsspecifik LAMP assay blev testet under anvendelse af et panel af rene DNA-prøver, der repræsenterer alle syv Eimeria arter, der inficerer kylling, samt kylling genomisk DNA som en masse kontrol. Agarosegelelektroforese blev anvendt til at løse hvert assay og viste absolut artsspecificitet med ingen vært krydsreaktivitet 18. Dernæst en ti-fold seriefortynding serie fremstillet ved anvendelse af renset Eimeria tenella genomisk DNA afslørede en analyse følsomhed grænse på mellem en og ti genom kopier 18. Ingen øvre grænse blev bestemt med positive resultater til og med den højeste koncentration (100.000 genom kopier) 18. Ansøgning med feltprøver Prøver indsamles til Eimeria test vil sandsynligvis stamme fra kyllinger fundet døde, aflivet som følge af poor sundhed eller udsat for sentinel helbredskontrol, hvilket indikerer en sandsynlighed stikprøvestørrelse på mellem et og tre, når en del af en rutine. Test tre fugle indsamlet fra en amerikansk slagtekyllinger gård som en del af et overvågningsprogram gav tre sæt tarmprøver. Målrettet anvendelse af artsspecifikke LAMP assays, prioritere de foretrukne tarm websteder for hver Eimeria arter (tabel 1), tillod visuel identifikation af eimerian infektion i alle fugle testet ved hjælp hydroxynaphthol blå som indikator (figur 2A). Det opnås med en negativ LAMP reaktion ved brug hydroxynaphthol blå farve kan variere fra violet til pink, men er altid forskellig fra blå opnås ved et positivt resultat. Bekræftelse ved agarosegelelektroforese billede sammenlignelige resultater (figur 2B). Under feltet ansøgning kan brugeren vælge at anvende fuld skærm mod alle syv arter, eller målrette kun de arter prioriteret somvigtigt eller vides at være i omløb på bedriften eller omgivelserne. Den manglende PCR-baserede metoder til at blive etableret som diagnostik for forekomsten af Eimeria understreger kravet om enkelhed i en ny test. Mens LAMP tilbyder enklere fremstilling og forarbejdning end PCR, kravet om at teste flere tarm steder pr fugl forbliver nedslående. Fremstilling af en enkelt poolet DNA prøve pr fugl, som derefter kan testes med en eller flere LAMP assays, vil sandsynligvis være mere tiltalende. Behandling én samleprøve pr fugl, der repræsenterer materiale indsamlet fra hver af de specifikke tarm lokaliteter beskrevet i tabel 1 og pulje før DNA forberedelse, til prøvning med alle syv LAMP analyser forudsat det samme resultat som når hver tarm websted blev behandlet særskilt (figur 2 sammenlignet med figur 3). <img alt="Figur 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot; /&gt; Figur 1. Intestinale prøvetagningssteder for LAMP påvisning af Eimeria arter parasitter, der inficerer kyllinger. Tarmens regioner er mål for hver Eimeria art fremhæves af de farvede linjer, med de foretrukne steder for prøveudtagning angivet ved tallet mellem de stiplede sorte streger (E. acervulina: gul / 1, E. Brunetti: pink / 2, E. maxima: blå / 3, E. mitis: orange / 4, E. necatrix: rød / 5, E. praecox: grøn / 6 og E. tenella: grå / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">Klik her for at se en større udgave af dette tal.</a> <img alt="Figur 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> Figur 2. LAMP diagnose af eimerian infektion from tre kommercielle slagtekyllinger. LAMP reaktioner løses ved hjælp af (A) hydroxynaphthol blå, hvor en sky blue reaktion var positiv og en violet til lyserød reaktion var negativ, og (B) agarosegelelektroforese. De intestinale sites stikprøven var som vist i tabel 1 for hver parasitart. A = E. acervulina, B = E. Brunetti, Ma = E. maksima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. Bane 1 indeholdt GeneRuler 1 kb DNA-stige. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">Klik her for at se en større udgave af dette tal.</a> <img alt="Figur 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> Figur 3. LAMP diagnose af eimerian infektion anvender fælles prøver fra tre forskellige kommercielle slagtekyllinger. LAMP reaktioner løses ved hjælp hydroxynaphthol blå, hvor en himmelblå reaktion var positiv og violet til lyserød reaktion var negativ. A = E. acervulina, B = E. Brunetti, Ma = E. maksima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">Klik her for at se en større udgave af dette tal.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Prøvested </td><td> Eimeria arter assay (mest sandsynligt) </td></tr><tr><td> Duodenum (D) </td><td> E. acervulina, E. praecox </td></tr><tr><td> Jejunum / ileum * (J / I) </td><td> E. maxima, E. necatrix </td></tr><tr><td> Caecum (C) </td><td> E. necatrix, E. tenella </td></tr><tr><td> Terminale ileum (TI) </td><td> E. Brunetti, E. mitis </td></tr&gt; <tr><td> Samleprøve (P) </td><td> E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella </td></tr></tbody></table> Tabel 1. Intestinal områdespecifik udvælgelse af kandidat Eimeria arter assays. Valget af område, der skal udtages prøver varierer for hver Eimeria arter som illustreret i figur 1. Puljede prøver omfatter materiale indsamlet fra alle fire bestemte websteder, som derefter blev kombineret til DNA-forberedelse. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Primer * </td><td> Stock koncentration (uM) </td><td> Volume (ul) </td></tr><tr><td> Vand </td><td> - </td><td> 60 </td></tr><tr><td> Forward Inner Primer (FIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Baglæns Inner Primer (BIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> Forward Outer Primer (F3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Baglæns Outer Primer (B3) </td><td> 100 </td><td> 10 </td></tr><tr><td> Loop Forward (LF) </td><td> 100 </td><td> 20 </td></tr><tr><td> Loop tilbage (LB) </td><td> 100 </td><td> 20 </td></tr><tr><td> Total </td><td></td><td> 200 </td></tr></tbody></table> Tabel 2. Forberedelse af en lampe primer premix. Komponenterne og proportioner, der er nødvendige for at forberede en primer premix til lampe. Mængderne vises er for 100 LAMP reaktioner. * Primer identiteter som vist i Materialer og Barkway et al (2011) 18. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Stock conc n </td><td> Final reaktion conc n </td><td> Volumen pr reaktion (pi) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> THERMOPOL buffer </td><td> 10 x </td><td> 1 x </td><td> 2.5 </td></tr><tr><td> MgSO4 </td><td> 100 mM </td><td> 2 mM </td><td> 0,5 </td></tr><tr><td> Primer mix * </td><td colspan="2"> Tabel 2 </td><td> 2.5 </td></tr><tr><td> dNTPs </td><td> 25 mM </td><td> 400 uM </td><td> 0.4 </td></tr><tr><td> Betain </td><td> 5 M </td><td> 1 M </td><td> 5 </td></tr><tr><td> Hydroxynaphthol blå </td><td> 3 mM </td><td> 120 uM </td><td> 1 </td></tr><tr><td> Bst DNA-polymerase </td><td> 8000 U / ml </td><td> 8 U </td><td> 1 </td></tr><tr><td> Total </td><td></td><td></td><td> 23 </td></tr></tbody></table> Tabel 3. Udarbejdelse af en LAMP reaktion mastermiksens. * Eimeria artsspecifik.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Loop-medieret Isotermisk Amplification (lampe) assays til Art-specifik påvisning af<em&gt; Eimeria</em&gt; Der inficerer Kyllinger

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Protein Misfolding Cyclic Amplification of Prions

Protein misfoldning Cyklisk Amplifikation af Prioner

Prions  are infectious agents that cause the inevitably fatal transmissible spongiform  encephalopathy (TSE) in animals and humans9,18. The prion protein ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

Assays til identifikation af nye Antivirale mod bluetonguevirus

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

En protokol til at inficere<em&gt; Caenorhabditis elegans</em&gt; Med<em&gt; Salmonella typhimurium</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Tidlig Virale Adgangskrav Analyser for identifikation og evaluering af antivirale forbindelser

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Kvalitative og kvantitative Analyser for påvisning og karakterisering af Protein Antimikrobielle stoffer

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Udviklingen af ​​Frysetørret Loop-medierede Isotermiske Amplification reagenser til påvisning af<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...