Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Assay Mélange Préparation <ol><li> Faire des concentrations 100 pmol / L de stock pour toutes les amorces dans l&#39; eau moléculaire de qualité et des sondes de pH 8 tampon TE [Entéro F1A, Entéro R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Note: Les sondes pour les deux cibles sont marquées par fluorescence avec différents fluorophores 7 , comme indiqué dans la liste des matériaux / équipement. </li><li> Préparer mélange maître en mélangeant, par réaction ...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

Il y a quelques étapes critiques dans le protocole. Tout d&#39;abord, le mélange des mélanges d&#39;essai peut être difficile parce que le mélange maître est plus visqueux que les mélanges maîtres qPCR classiques. tourbillonnement simple peut conduire à un mélange insuffisant, ce qui à son tour conduit à une distribution non uniforme des matrices d&#39;ADN dans les mélanges d&#39;essai, puis dans les gouttelettes. La technique de mélange par pipetage décrit dans le protocole doit être suivi pour assurer ...

Les méthodes quantitatives PCR (qPCR) ont été largement utilisés à des fins récréatives surveillance de la qualité de l&#39;eau et microbiennes des applications de suivi de la source, car ils sont plus rapides, plus flexibles et spécifiques par rapport aux méthodes basées sur la culture traditionnelle. Par conséquent, qPCR est recommandé pour obtenir des résultats de surveillance des eaux rapides des indicateurs fécaux généraux tels que Enterococcus spp. , Dans la version révisée de l&#39; EPA eau récréative des critères de qualité 1. De nombreux essais qPCR ont également été mis au point et validé pour identifier les sources de contamination fécale dans les eaux environnementales 2. Parmi ceux - ci, le dosage des marqueurs HF183 sont parmi les plus fréquemment utilisés pour identifier la contamination fécale 3 humaine associée. Cependant, les résultats de qPCR peuvent souvent être biaisés car elles reposent sur des courbes standards pour la quantification. qPCR quantifie concentrations inconnues de cible dans les échantillons par interpolation de leur cycle de quantification (Cq) à partir d&#39;un stancourbe de norme qui décrit une relation linéaire entre Cq et la quantité logarithmique d&#39;un ensemble de normes en série dilué. Le manque de matériel de référence standard fiable et cohérente peut donc fausser considérablement les résultats de qPCR. Des études ont montré que les résultats de qPCR différaient d&#39;environ un demi - log en utilisant des normes de différents fournisseurs et 4 par 2 fois en utilisant différents lots de normes du même fournisseur 5. PCR (RCPH) La technologie numérique quantifie un échantillon inconnu en comptant la fréquence des points positifs dans un grand nombre de RFP miniatures qui sont générés par le partitionnement d&#39; un qPCR en vrac dans des milliers ou des millions de nanolitre uniforme ou réactions picolitres 6. Il est mentionné que gouttelette PCR numérique (c. -à cet article) ou une chambre PCR numérique, respectivement, si les partitions sont des gouttelettes d&#39; eau dans l&#39;huile ( par exemple, cet article) ou de petites chambres sur une puce. Une concentration plus élevée de l&#39;échantillon se traduira par la présence de l&#39;ADN cible(PCR donc positif) dans une proportion plus élevée de partitions, une relation approchée par la loi de Poisson. En tant que tel, les résultats binaires (PCR positive ou négative) sont enregistrées et la fréquence de gouttelettes positives sont utilisées pour calculer les concentrations d&#39;échantillons inconnus directement par approximation de Poisson, ce qui élimine la nécessité d&#39;une courbe standard comme dans qPCR. Cette nature binaire de quantification par PCR numérique offre des avantages supplémentaires sur qPCR 7. Parce que l&#39;amplification retardé peut encore obtenir une PCR positive RCPH quantification est plus robuste contre l&#39;inhibition qui réduit l&#39;efficacité de l&#39;amplification. De même, RCPH quantification ne soit pas affectée par la variabilité des valeurs Cq comme est qPCR, conduisant à une plus grande précision de RCPH par rapport à qPCR 8-10. En outre, le procédé de séparation assure une très petite quantité d&#39;ADN cible présente dans chaque goutte, ce qui réduit efficacement la concurrence du substrat (pendant amplification des différentes cibles d&#39;ADN) qui sont des obstacles communs à la réalisation de duplexage (ie un test mesure simultanément deux cibles d&#39;ADN) dans qPCR. En tant que tel, si l&#39; exécution en duplex ou simplex (ie une cible est mesurée en un seul essai) RCPH produit quantification presque indiscernables des deux cibles 7,11. Le but du test de PCR numérique (EntHF183 RCPH) décrit dans cet article est d&#39;obtenir une quantification directe simultanée de l&#39;indicateur fécal général Enterococcus spp. Et le marqueur HF183 humain-fécale associée à une précision améliorée, la reproductibilité et la robustesse contre l&#39; inhibition par rapport à son qPCR homologues. Ce test a été utilisé avec succès pour quantifier la contamination fécale dans l&#39; eau douce de l&#39; environnement, l&#39; eau de mer, et diverses matières fécales 7, mais peut également être appliquée à d&#39;autres types d&#39;eaux et des eaux usées. Ce test est très prometteur pour l&#39;analyse de sédiments ou des sols en raison de sons grande tolérance à l&#39;inhibition, mais des tests supplémentaires sont nécessaires en raison de la complexité du mélange inhibiteur dans ces types d&#39;échantillons.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Ce manuscrit décrit un test de PCR numérique duplex (EntHF183 RCPH) pour la quantification simultanée de Enterococcus spp. Et le marqueur humain HF183 fécale associée. Le EntHF183 duplex RCPH (dénommé EntHF183 RCPH de maintenant) test utilise les mêmes amorces et sondes séquences que ses PCR quantitative (qPCR) homologues individuels publiés. De même, les mêmes procédures de filtration d&#39;eau et d&#39;extraction d&#39;ADN effectuée avant qPCR sont suivies avant d&#39;exécuter RCPH. Cependant, le dosage duplex DPCR présente plusieurs avantages par rapport aux essais de qPCR. Plus important encore, le dosage RCPH élimine la nécessité d&#39;exécuter une courbe standard et donc, le biais et la variabilité associée, par quantification directe de ses objectifs. En outre, alors que duplexage (c. -à- quantification simultanée) Enterococcus et HF183 en qPCR conduit souvent à une sous - estimation grave de la cible moins abondante dans un échantillon, RCPH fournit une quantification cohérente des deux cibles, aiguisentelle quantifié individuellement ou simultanément dans la même réaction. Le dosage DPCR est également capable de tolérer des concentrations d&#39;inhibiteur de PCR qui sont un à deux ordres de grandeur plus élevées que celles tolérées par qPCR. Ces avantages font l&#39;essai EntHF183 RCPH particulièrement intéressante, car elle fournit simultanément des informations précises et reproductibles à la fois sur la contamination générale et humaine associée fécale dans les eaux environnementales sans la nécessité d&#39;exécuter deux essais qPCR séparés. En dépit de ses avantages sur qPCR, la limite de quantification supérieure du dosage RCPH avec instrumentation disponible actuellement est d&#39;environ quatre ordres de grandeur inférieure à celle obtenue par qPCR. Par conséquent, la dilution est nécessaire pour la mesure des concentrations élevées d&#39;organismes cibles, tels que ceux qui sont habituellement observés à la suite de déversements d&#39;eaux usées.

Un bon run EntHF183 duplex RCPH devrait se traduire par nombre relativement élevé de gouttelettes reconnues (ca. 10,000-17,000) et différence relativement importante (environ 5000) entre les valeurs de fluorescence pour gouttelettes négatives et positives 7. Exceptionnellement faible nombre de gouttelettes indique probablement des problèmes dans le processus de génération de gouttelettes, et un seuil de 10.000 gouttelettes est proposé sur la base des ...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Ce manuscrit décrit un essai PCR duplex numérique qui peut être utilisé pour quantifier simultanément Enterococcus spp. , Et les marqueurs génétiques HF183 comme indicateurs de contamination fécale générale et humaine associée dans les eaux récréatives.

Un test PCR Duplex numérique pour simultanée Quantification de la<em&gt; Enterococcus spp.</em&gt; Et le HF183 marqueur humain Fecal associé dans les eaux

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Détermination de l&#39;activité enzymatique microbienne extracellulaire dans les eaux, les sols et les sédiments de haut débit microplaques dosages

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Recherche

Environnement

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

ARN-ADN Extraction simultanée de sédiments côtiers et Quantification de 16S ARNr et Transcriptions par PCR en temps réel

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Clean Échantillonnage et analyse de la Rivière et estuariens Waters pour Trace études métalliques

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Protocole pour microplastiques échantillonnage sur la surface de la mer et analyse des échantillons

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Extraction de pesticides organochlorés à partir de granulés en plastique et analyse de type plastique

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

Le protocole de Hawaï pour un suivi scientifique de café térébrant : un modèle pour les agroécosystèmes cafés dans le monde entier

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Spécifique et une détection précise de Using PCR classique sur des échantillons de tissus foliaires agrumes Citrus Greening pathogène Candidatus liberibacter spp.

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Mesurer la capacité de vol de l’insecte Ambrosia, Platypus Quercivorus (Murayama), utilisant un Low-Cost et petit moulin de vol construit facilement

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Récolte de venin toxines d’Assassin Bugs et autres insectes hétéroptères

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...