Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Assay-Mischung Vorbereitung <ol><li> Machen Sie 100 &amp; mgr; mol / L Lager Konzentrationen für alle Primer in UPW Wasser und Sonden in TE pH 8 - Puffer [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Hinweis: Die Sonden für die beiden Ziele sind fluoreszierend mit unterschiedlichen Fluorophore 7 , wie in Liste der Materialien / Ausrüstung bezeichnet. </li><li> Bereiten Sie Master-Mix durch Mischen, pro Reaktion geplant, 12 ul digitale PCR-Mix (2x Lager...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

Es gibt einige wichtige Schritte in dem Protokoll. Erstens kann der Testgemische Mischen schwierig sein, da der Master-Mix mehr viskos ist als herkömmliche qPCR Master Mixes. Einfache Vortexen kann zu einer unzureichenden Durchmischung führen, was wiederum zu einer ungleichmäßigen Verteilung von DNA-Matrizen in den Testgemischen und anschließend in den Tröpfchen. Die Misch-by-Pipettiertechnik in dem beschriebenen Protokoll müssen befolgt werden, um genaue dPCR Quantifizierung zu gewährleisten. Zweitens ist es wi...

Quantitative PCR (qPCR) Verfahren wurden für die Freizeit-Überwachung der Wasserqualität und mikrobiellen Quelle Tracking-Anwendungen weit verbreitet, weil sie schneller sind, flexibler und spezifischer im Vergleich zu traditionellen Kultur-basierten Methoden. Folglich wird qPCR für die Erzielung eines raschen Wasserüberwachungsergebnisse für die allgemeine fäkale Indikatoren wie Enterococcus spp empfohlen. In den überarbeiteten USEPA Erholungswasserqualitätskriterien 1. Viele qPCR - Assays wurden auch zur Identifizierung von Quellen von fäkale Verunreinigungen in Umwelt Gewässer 2 entwickelt und validiert. Unter diesen sind die HF183 Marker - Assays unter den am häufigsten verwendeten zur Identifizierung von Menschen assoziiert fäkale Verunreinigung 3. Jedoch kann qPCR Ergebnisse oft vorgespannt werden, da sie auf Standardkurven für die Quantifizierung verlassen. qPCR quantifiziert unbekannten Konzentrationen von Ziel in Proben, die durch ihre Quantifizierung Zyklus Interpolation (CQ) von einem standard Kurve, die eine lineare Beziehung zwischen Cq und logarithmische Menge einer Gruppe von seriell verdünnten Standards beschrieben. Der Mangel an zuverlässigen und konsistenten Standardreferenzmaterial kann daher vorspannen stark qPCR Ergebnisse. Studien zeigten , dass qPCR Ergebnisse um etwa die Hälfte ein Protokoll unter Verwendung von Standards von verschiedenen Anbietern unterschiedlich 4 und durch 2-fach verschiedenen Chargen von Standards vom gleichen Hersteller 5 verwenden. Digital PCR (dPCR) -Technologie quantifiziert eine unbekannte Probe durch die Frequenz von Positiven in eine große Anzahl von Miniatur - PCRs zählen , die 6 durch Partitionieren eines bulk qPCR in Tausende oder Millionen von gleichförmigen Nanoliter oder Pikoliter - Reaktionen erzeugt werden. Es wird als Tröpfchen digital PCR (dh in diesem Artikel) oder Kammer digitalen PCR jeweils bezeichnet, wenn die Trennwände Wasser-in-Öl - Tröpfchen (dh in diesem Artikel) oder kleine Kammern auf einem Chip sind. Eine höhere Probenkonzentration wird in Anwesenheit von Ziel-DNA führen(Daher positive PCR) in einem höheren Anteil von Trennwänden, eine Beziehung, die durch Poisson-Verteilung angenähert. Als solche sind die binären Ergebnisse (positive oder negative PCR) erfasst und die Frequenz der positiven Tröpfchen verwendet wird unbekannten Probenkonzentrationen direkt über Poisson Approximation zu berechnen, wodurch die Notwendigkeit für eine Standardkurve wie in qPCR eliminieren. Diese binäre Art der digitalen PCR Quantifizierung bietet zusätzliche Vorteile gegenüber qPCR 7. Da verzögerte Verstärkung noch eine positive PCR ergeben können, ist dPCR Quantifizierung robuster gegenüber Hemmung, die Verstärkungseffizienz verringert. In ähnlicher Weise wird dPCR Quantifizierung nicht durch Variabilität in Cq - Werte betroffen wie qPCR ist, zu einer höheren Genauigkeit der dPCR führt im Vergleich zu qPCR 8-10. Darüber hinaus gewährleistet das Unterteilungsprozesses eine sehr kleine Menge an Ziel-DNA in jedem Tröpfchen, Substrat Wettbewerb effektiv minimiert wird (während amplification der verschiedenen DNA - Targets), die gemeinsame Hindernisse für Duplex- zu erreichen (dh ein Test misst gleichzeitig zwei DNA - Targets) in qPCR. Als solches ob Lauf im Duplex- oder Simplex (dh ein Ziel in einem einzigen Assay gemessen wird) dPCR produziert fast nicht zu unterscheiden Quantifizierung beider Ziele 7,11. Das Ziel des digitalen PCR - Assay (EntHF183 dPCR) in diesem Artikel beschriebene gleichzeitige direkte Quantifizierung der allgemeinen fäkale Indikator Enterococcus spp zu erhalten. Und die human-fäkale assoziiert HF183 Marker mit verbesserter Genauigkeit, Reproduzierbarkeit und Robustheit gegenüber Hemmung im Vergleich zu seiner qPCR Pendants. Dieser Assay wurde zur Quantifizierung der fäkalen Kontamination in Umwelt Süßwasser, Meerwasser, und verschiedene Fäkalmaterial 7, kann aber auch angewendet werden auf andere Arten von Gewässern und Abwässern eingesetzt. Dieser Test ist sehr vielversprechend für Sedimente oder Böden aufgrund seiner Analyses eine hohe Toleranz gegenüber der Hemmung, aber weitere Tests wegen Komplexitäten erforderlich Inhibitor in diesen Arten von Proben vermischt.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Dieses Manuskript beschreibt eine Duplex - Digital - PCR - Assays (EntHF183 dPCR) für die simultane Quantifizierung von Enterococcus spp. Und dem menschlichen HF183 Marker fäkal-assoziiert. Die EntHF183 Duplex dPCR (bezeichnet als EntHF183 dPCR hereon) Test verwendet die gleichen Primer und Sonden-Sequenzen wie die veröffentlichten Einzel quantitative PCR (qPCR) Pendants. Ebenso wie die gleichen Wasserfiltration und DNA-Extraktionsverfahren vor der qPCR durchgeführt werden, bevor anschließend dPCR zu laufen. Jedoch hat der duplex dPCR Assay mehrere Vorteile gegenüber den qPCR-Assays. Am wichtigsten ist, beseitigt die dPCR Assay die Notwendigkeit für eine Standardkurve ausgeführt wird und somit die zugeordnete Bias und Variabilität, durch direkte Quantifizierung ihrer Ziele. Darüber hinaus, während Duplexing (dh simultane Quantifizierung) Enterococcus und HF183 in qPCR führt oft zu schweren Unterschätzung der weniger reichlich Ziel in einer Probe stellt dPCR konsistente Quantifizierung beider Ziele, wetzensie einzeln oder gleichzeitig in dem gleichen Reaktions quantifiziert. Der dPCR Assay ist auch in der Lage PCR Inhibitorkonzentrationen zu tolerieren, 1.59 Grßenordnungen höher sind als diejenigen, die durch qPCR toleriert. Diese Vorteile machen die EntHF183 dPCR Test besonders attraktiv, weil es bietet gleichzeitig präzise und wiederholbare Informationen über allgemeine und Mensch-assoziierte fäkale Verunreinigungen in Umwelt Gewässern ohne die Notwendigkeit zwei getrennte qPCR-Assays auszuführen. Trotz seiner Vorteile gegenüber qPCR, wobei der obere Bestimmungsgrenze des dPCR Assay mit derzeit verfügbaren Instrumentierung ist ungefähr vier Größenordnungen niedriger als die erzielbaren qPCR. Folglich wird Verdünnung für die Messung hoher Konzentrationen von Zielorganismen erforderlich, wie sie typischerweise folgende Abwasser Verschüttungen beobachtet.

Eine gute EntHF183 duplex dPCR Lauf in relativ hohe Anzahl von akzeptierten Tröpfchen (ca. 10,000-17,000) und relativ große Differenz (ca. 5000) zwischen Fluoreszenzwerte für negative und positive Tröpfchen 7 führen. Ungewöhnlich niedrige Anzahl von Tröpfchen gibt wahrscheinlich Probleme in der Tröpfchenerzeugungsprozess und einen Cutoff von 10.000 Tröpfchen basiert auf empirischen Daten aus dem Tröpfchen dPCR System in diesem Artikel verwendeten vo...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Diese Handschrift beschreibt eine Duplex digitalen PCR Assay , die gleichzeitig verwendet werden können , um Enterococcus spp quantifizieren. Und die HF183 genetischen Markern als Indikatoren für allgemeine und menschlichen assoziiertes fäkale Verunreinigung in Erholungsgewässern.

Eine Duplex-Digital-PCR-Assay für Simultaneous Quantifizierung der<em&gt; Enterococcus spp.</em&gt; Und das menschliche Fecal-assoziierte HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Bestimmung mikrobieller extrazelluläre Enzymaktivität in Wasser, Böden und Sedimente mit hohem Durchsatz Mikrotiterplatten-Assays

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Forschung

Umwelt

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Farbmetrische Papierbasierte Erkennung von<em&gt; Escherichia coli</em&gt;,<em&gt; Salmonellen</em&gt; Spp. Und<em&gt; Listeria monocytogenes</em&gt; Von großen Mengen von Landwirtschaftliche Wasser

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Gleichzeitige DNA-RNA-Extraktion aus Küstensedimenten und Quantifizierung von 16S rRNA-Gene und Transkripte von Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Saubere Probenahme und Analyse von River und Estuarine Waters für Spurenmetallforschung

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Protokoll für die Mikroplastik Probenahme auf der Meeresoberfläche und Probenanalyse

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Extraktion von Organochlor-Pestiziden aus Kunststoff-Pellets und Kunststoff-Typ-Analyse

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

Das Hawaii-Protokoll für die wissenschaftliche Begleitung des Kaffee Berry Borer: ein Modell für Kaffee Agrarökosystemen weltweit

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Spezifische und präzise Erkennung von Citrus Greening Erreger Verbindung Liberibacter spp mit konventionellen PCR auf Citrus Blatt Gewebeproben

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Messung der Flug Fähigkeit des Käfers Ambrosia, Platypus Quercivorus (Murayama), mit einem Low-Cost, klein und leicht konstruierte Flug Mühle

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Ernte Venom Giftstoffe aus Assassin Bugs und andere Heteropteran Insekten

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...