Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. תערובת Assay כן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך 100 μmol / L ריכוזי מניות לכל פריימרים במי כיתה מולקולריים בדיקות במאגר TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. הערה: בדיקות עבור שתי המטרות מסומנות fluorescently עם 7 fluorophores השונים כמצ...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

ישנם כמה צעדים קריטיים בפרוטוקול. ראשית, ערבוב של תערובות assay יכול להיות קשה, כי את תערובת מאסטר היא צמיגה יותר מאשר תערובות מאסטר qPCR קונבנציונליות. vortexing פשוט עלול להוביל ערבוב מספיק, אשר בתורו מוביל הפצה לא אחידה של תבניות DNA של תערובות assay וכפועל יוצא מזה הטיפות. טכני...

PCR כמוני (qPCR) שיטות כבר בשימוש נרחב לניטור איכות מי פנאים ויישומי מעקב מקור חיידקים כי הם מהירים יותר, גמישים יותר ספציפיים בהשוואה לשיטות תרבות המבוססת מסורתיות. כתוצאה מכך, qPCR מומלץ להשגת תוצאות ניטור מים מהירות עבור אינדיקטורים צואתי כלליים כגון spp אנטרוקוקוס. בקריטריוני איכות מי פנאי מתוקן USEPA 1. מבחני qPCR רבים גם פותחו ומאומתים לזיהוי מקורות זיהום צואתי במי סביבת 2. בין אלה, מבחני סמן HF183 הם בין הנפוצות ביותר בשימוש לזיהוי זיהום צואתי הקשורים האדם 3. עם זאת, תוצאות qPCR יכול לעיתים קרובות להיות מוטים כי הם מסתמכים על עקומות סטנדרטיות עבור כימות. qPCR מכמת ריכוזים ידועים של יעד בדגימות על ידי ביון מחזור הכימות שלהם (CQ) מתוך סטןעקומת dard המתארת ​​מערכת יחסים ליניארי בין Cq וכמות לוגריתמים של סט של סטנדרטים בדילול סדרתי. חוסר חומר עזר תקן אמין ועקבי ולכן יכול להטות תוצאות qPCR מאוד. מחקרים הראו כי תוצאות qPCR שונות על ידי כחצי סטנדרטי יומן באמצעות מיצרנים שונים 4 ועל ידי 2-לקפל באמצעות קבוצות שונות של סטנדרטים מאותו הספק 5. PCR דיגיטלי (dPCR) טכנולוגיה מכמתת מדגם לא ידוע על ידי ספירת התדירות חיובית במספרים גדולים של PCRs מיניאטורי המופקים על ידי מחיצות qPCR בתפזורת לתוך אלף או מ&#39;nanoliter האחיד או תגובות picoliter 6. זה נקרא כמו אגל PCR דיגיטלי (כלומר, במאמר זה) או תא דיגיטלי PCR, בהתאמה, אם המחיצות הן טיפות מים ב-שמן (כלומר, במאמר זה) או תא קטן על שבב. ריכוז מדגם גבוה יגרום נוכחות של DNA היעד(ומכאן חיובי PCR), בשיעור גבוה יותר של מחיצות, מערכת יחסים המקורבים על ידי התפלגות פואסון. ככזה, התוצאות בינארי (חיובי או שלילי PCR) נרשמות ואת התדירות של טיפות חיוביות משמשת לחישוב ריכוזים מדגמים לא ידועים ישירות דרך קירוב פואסון, ביטול הצורך עקום סטנדרט כמו qPCR. הטבע בינארי זה של כימות דיגיטלי PCR מספק יתרונות נוספים על פני qPCR 7. בגלל הגברה מתעכבת עדיין יכולה להניב PCR חיובי, כימות dPCR הן חזקות יותר נגד עיכוב המפחיתה יעילה הגברה. באופן דומה, כימות dPCR אינו מושפע השתנות בערכים Cq כמו qPCR, שמוביל דיוק גבוה של dPCR לעומת qPCR 8-10. בנוסף, תהליך יצירת המחיצות מבטיח כמות קטנה מאוד של הנוכחי DNA יעד בכל אגל, מזעור תחרות מצע ביעילות (במהלך amplification של מטרות DNA שונות) כי הם מכשולים נפוצים להשגת דופלקס (כלומר assay מודד בעת ובעונה אחת שתי מטרות DNA) qPCR. ככזה, אם בטווח בדופלקס או סימפלקס (כלומר יעד אחד נמדד ב assay אחת) dPCR מייצרת כימות כמעט נבדלות של שני היעדים 7,11. המטרה של assay PCR הדיגיטלי (EntHF183 dPCR) המתוארת במאמר זה היא להשיג כימות ישירה סימולטני של spp אנטרוקוקוס מחוון צואתי הכללי. ואת סמן HF183 הקשורים אדם-צואה עם דיוק, שחזור וחוסנם משופרים מפני עיכוב לעומת qPCR שלה עמיתים. Assay זה נוצל בהצלחה לכימות זיהום צואתי במים מתוקים סביבה, מים ימיים, חומר צואתי שונה 7, אבל יכול גם להיות מיושם על כל סוגים אחרים של מים ואת wastewaters. assay זה טומן בחובו הבטחה גדולה לניתוח משקע או קרקעות בגלל זהזה סובלנות גבוהה עיכוב, אך בדיקות נוספות נדרשות בשל מורכבות של המעכב מתערבב סוגים אלה של דגימות.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס (EntHF183 dPCR) כימות סימולטני של spp אנטרוקוקוס. ואת סמן HF183 צואה הקשורים האדם. EntHF183 דופלקס dPCR (המכונה בשם EntHF183 dPCR hereon) assay משתמשת באותו רצפים פריימר בדיקה כמו PCR כמותי הפרט שפורסם שלה (qPCR) עמיתיהם. כמו כן, אותם הליכי סינון מי מיצוי DNA כפי שבוצע לפני qPCR הם אחריו לפני הפעלת dPCR. עם זאת, assay דופלקס dPCR יש מספר יתרונות על פני מבחני qPCR. החשוב ביותר, assay dPCR מבטל את הצורך לרוץ עקומת סטנדרט ומכאן, ההטיה הקשורה ולהבדלים, על ידי כימות ישיר של מטרותיה. בנוסף, בעוד להדפסה דו-צדדי (כלומר כימות סימולטני) אנטרוקוקוס ו HF183 ב qPCR מוביל לעתים קרובות הערכה נמוכה מדי חמורה של היעד השופע פחות במדגם, dPCR מספק כימות עקבית של המטרות הן, לגרותלה לכמת בנפרד או בו-זמנית באותו התגובה. את assay dPCR הוא גם מסוגל לסבול ריכוזי מעכב PCR כי הם אחד שני סדרי גודל גבוה יותר מאלו נסבלים על ידי qPCR. יתרונות אלו הופכים את assay EntHF183 dPCR אטרקטיבי במיוחד משום שהיא בעת ובעונה אחת מספקת מידע מדויק דיר משני הזיהום הכללי ואנושיים הקשורים צואתי במי סביבה, ללא הצורך להפעיל שני מבחני qPCR נפרדים. למרות יתרונותיה מעל qPCR, מגבלת הכימות העליונה של assay dPCR עם מכשור הקיימות כיום כ ארבעה סדרי גודל נמוך מזה השגה על ידי qPCR. כתוצאה מכך, הדילול נדרש למדידת ריכוזים גבוהים של אורגניזמים היעד כגון אלו שנצפו בדרך כלל בעקבות נשפך ביוב.

ריצת דופלקס EntHF183 טובה dPCR צריכה לגרום למספר גבוה היחסי של טיפות קבלו (בערך 10,000-17,000) והבדל גדול יחסית (בערך 5,000) בין ערכי קרינה עבור טיפות שליליות וחיוביות 7. באופן חריג מספר נמוך של טיפות מציין בעיות קרוב בתהליך אגל הדור, וניתוק 10,000 טיפות...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס, שניתן להשתמש בהם כדי לכמת spp אנטרוקוקוס זמנית. ואת סמנים גנטיים HF183 כאינדיקטורים לזיהום צואתי כללית אדם הקשורים במים פנאי.

Assay PCR דיגיטלי דופלקס כימות סימולטני של<em&gt; Spp אנטרוקוקוס.</em&gt; ואת מרקר HF183 הקשורים צואת האדם ווטרס

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

קביעת מיקרוביאלית התאית אנזים הפעילות במים, קרקעות, ומשקעים באמצעות מבחני Microplate תפוקה גבוהה

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

מבוסס נייר Colorimetric איתור של<em&gt; חיידקי Escherichia</em&gt;,<em&gt; סלמונלה</em&gt; Spp., ו<em&gt; חיידקי ליסטריה</em&gt; מכמויות גדולות של מים לחקלאות

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

הפקת DNA-RNA סימולטני החוף משקעים וכימות של 16S rRNA גנים תעתיקי ידי בזמן אמת PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

נקי דיגום ואנליזה של נהר ושפכי הנהרות ווטרס ללימודי מתכת עקבות

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

פרוטוקול עבור דגימת חלקיקים על פני הים וניתוח לדוגמא

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

הפקת חומרי הדברה אורגנוכלורינים מפלסטיק וגלגול סוג פלסטיק

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

פרוטוקול הוואי עבור ניטור המדעי של קפה ברי בורר: מודל עבור קפה Agroecosystems ברחבי העולם

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

ספציפית, איתור מדויק של spp. הפתוגן ירוק הדרים Candidatus liberibacter באמצעות PCR המקובלת על דגימות רקמה עלה הדרים

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

מדידת היכולת טיסה של החיפושית אמברוזיה, ברווזן Quercivorus (Murayama), באמצעות בעלות נמוכה, קטנה, טיסה מתוכננת בקלות מיל

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

קציר ארס מרעלים חרקים טורפים וחרקים אחרים Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...