Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. परख मिश्रण तैयारी <ol><li> ते 8 पीएच बफर में आणविक ग्रेड पानी में सभी प्राइमरों और जांच [Entero F1A, Entero R1, GPL813TQ 12 के लिए 100 μmol / एल शेयर सांद्रता करें; HF183-1, BthetR1, BthetP1 3]। नोट: दो लक्ष्यों के लिए जांच fluorescently विभिन्न fluorophores <...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

प्रोटोकॉल में कुछ महत्वपूर्ण कदम उठाए हैं। सबसे पहले, परख मिश्रण के मिश्रण के लिए मुश्किल हो सकता है क्योंकि मास्टर मिश्रण पारंपरिक qPCR मास्टर घोला जा सकता है और अधिक से अधिक चिपचिपा है। सरल vortexing अपर्याप...

मात्रात्मक पीसीआर (qPCR) तरीकों में व्यापक रूप से, क्योंकि वे तेजी से और अधिक लचीला और पारंपरिक संस्कृति आधारित विधियों की तुलना में विशिष्ट हैं मनोरंजक पानी की गुणवत्ता की निगरानी और माइक्रोबियल स्रोत आवेदन पर नज़र रखने के लिए इस्तेमाल किया गया है। नतीजतन, qPCR संशोधित USEPA मनोरंजन पानी की गुणवत्ता मानदंड 1 में इस तरह के उदर एसपीपी के रूप में सामान्य मल संकेतकों के लिए तेजी से पानी की निगरानी परिणाम प्राप्त करने के लिए सिफारिश की है।। कई qPCR assays भी विकसित और पर्यावरण के जल 2 में मल प्रदूषण के स्रोतों की पहचान के लिए मान्य किया गया है। इन के अलावा, HF183 मार्कर assays के सबसे अधिक बार मानव-मल जुड़े संदूषण 3 की पहचान करने के लिए इस्तेमाल शामिल हैं। हालांकि, qPCR परिणाम अक्सर पक्षपातपूर्ण हो सकता है क्योंकि वे मात्रा का ठहराव के लिए मानक घटता पर भरोसा करते हैं। qPCR एक स्टेन से उनकी मात्रा का ठहराव चक्र (सीक्यू) interpolating द्वारा नमूनों में लक्ष्य के अज्ञात सांद्रता quantifiesदर्द की अवस्था है कि Cq और क्रमानुसार-पतला मानकों का एक सेट के लघुगणक मात्रा के बीच एक रैखिक संबंध का वर्णन है। विश्वसनीय और संगत मानक संदर्भ सामग्री का अभाव इसलिए बहुत qPCR परिणाम पूर्वाग्रह कर सकते हैं। अध्ययन से पता चला है कि qPCR परिणाम विभिन्न विक्रेताओं से 4 मानकों का प्रयोग लगभग आधे से एक लॉग से भिन्न है और एक ही विक्रेता से 5 मानकों के विभिन्न बैचों का उपयोग कर 2 गुना से। डिजिटल पीसीआर (dPCR) तकनीक लघु PCRs की बड़ी संख्या है कि हजारों या वर्दी nanoliter या picoliter प्रतिक्रियाओं 6 के लाखों में एक थोक qPCR विभाजन से उत्पन्न कर रहे हैं में सकारात्मक की आवृत्ति की गणना के द्वारा एक अज्ञात नमूना quantifies। यह छोटी बूंद डिजिटल पीसीआर (यानी, इस लेख) या चैम्बर डिजिटल पीसीआर, क्रमशः के रूप में जाना जाता है, तो विभाजन पानी में तेल की बूंदों (यानी, इस लेख) या एक चिप पर छोटे कक्षों हैं। एक उच्च नमूना एकाग्रता लक्ष्य डीएनए की उपस्थिति में परिणाम होगा(इसलिए सकारात्मक पीसीआर) विभाजन की एक उच्च अनुपात में, एक रिश्ता पॉसों वितरण द्वारा approximated। जैसे, द्विआधारी परिणाम (सकारात्मक या नकारात्मक पीसीआर) दर्ज कर रहे हैं और सकारात्मक बूंदों की आवृत्ति पॉसों सन्निकटन के माध्यम से सीधे अज्ञात नमूना सांद्रता गणना करने के लिए, qPCR में के रूप में एक मानक वक्र के लिए आवश्यकता को नष्ट किया जाता है। डिजिटल पीसीआर गुणात्मक रूप से इस द्विआधारी प्रकृति qPCR 7 पर अतिरिक्त लाभ प्रदान करता है। क्योंकि देरी प्रवर्धन अभी भी एक सकारात्मक पीसीआर उपज कर सकते हैं, dPCR मात्रा का ठहराव निषेध कि प्रवर्धन क्षमता कम कर देता खिलाफ और अधिक मजबूत है। इसी तरह, dPCR मात्रा का ठहराव Cq मूल्यों में परिवर्तनशीलता से प्रभावित नहीं है के रूप में, qPCR है qPCR 8-10 की तुलना में dPCR के उच्च परिशुद्धता के लिए अग्रणी। इसके अलावा, विभाजन की प्रक्रिया, एक छोटी बूंद में लक्ष्य डीएनए की एक बहुत छोटी राशि सुनिश्चित करता है को प्रभावी ढंग से सब्सट्रेट प्रतियोगिता को न्यूनतम (amplificatio दौरानअलग डीएनए लक्ष्य) कि (यानी एक परख एक साथ दो लक्ष्यों को डीएनए के उपाय) qPCR में duplexing को प्राप्त करने के लिए आम बाधाएं हैं के एन। जैसे, चाहे द्वैध या सिंप्लेक्स में रन (यानी एक लक्ष्य के लिए एक एकल परख में मापा जाता है) dPCR दोनों लक्ष्यों को 7,11 के लगभग अप्रभेद्य मात्रा का ठहराव पैदा करता है। डिजिटल पीसीआर परख (EntHF183 dPCR) इस आलेख में वर्णित के लक्ष्य के सामान्य मल सूचक Enterococcus एसपीपी के एक साथ प्रत्यक्ष मात्रा का ठहराव प्राप्त करने के लिए है। और मानव-मल जुड़े सुधार परिशुद्धता, reproducibility और निषेध के खिलाफ मजबूती के साथ HF183 मार्कर अपने qPCR की तुलना समकक्षों। इस परख सफलतापूर्वक पर्यावरण मीठे पानी, समुद्री पानी, और विभिन्न fecal सामग्री 7 में मल प्रदूषण को बढ़ाता के लिए इस्तेमाल किया गया है, लेकिन यह भी पानी और अपशिष्ट जल के किसी भी अन्य प्रकार के लिए लागू किया जा सकता है। इस परख की वजह से इसे करने के लिए तलछट या मिट्टी का विश्लेषण करने के लिए महान वादा धारणनिषेध करने के लिए उच्च सहिष्णुता है, लेकिन अवरोध के नमूनों की इन प्रकारों में घोला जा सकता है आगे के परीक्षण क्योंकि जटिलताओं के लिए जरूरी है।

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

यह पांडुलिपि Enterococcus एसपीपी के एक साथ मात्रा का ठहराव। और मानव मल से जुड़े HF183 मार्कर के लिए एक डुप्लेक्स डिजिटल पीसीआर परख (EntHF183 dPCR) का वर्णन है। EntHF183 द्वैध dPCR (EntHF183 dPCR के रूप में भेजा hereon) परख अपनी प्रकाशित व्यक्ति मात्रात्मक पीसीआर (qPCR) समकक्षों के रूप में एक ही किताब और जांच के दृश्य का उपयोग करता है। इसी तरह, एक ही पानी छानने का काम और डीएनए निष्कर्षण प्रक्रियाओं के रूप में qPCR करने से पहले किया dPCR चल रहा से पहले पालन कर रहे हैं। हालांकि, डुप्लेक्स dPCR परख qPCR assays पर कई फायदे हैं। सबसे महत्वपूर्ण है, dPCR परख एक मानक वक्र चल रहा है और इसलिए लिए की जरूरत है, जुड़े पूर्वाग्रह और परिवर्तनशीलता, अपने लक्ष्य के प्रत्यक्ष मात्रा का ठहराव द्वारा समाप्त। इसके अलावा, जबकि (यानी एक साथ मात्रा का ठहराव) उदर और qPCR में HF183 duplexing अक्सर एक नमूने में कम प्रचुर मात्रा में लक्ष्य के गंभीर मूल्यवान समझना की ओर जाता है, dPCR दोनों लक्ष्यों के अनुरूप मात्रा का ठहराव प्रदान करता है, whetउसकी व्यक्तिगत रूप से या एक साथ एक ही प्रतिक्रिया में मात्रा निर्धारित किया। dPCR परख भी पीसीआर अवरोध सांद्रता कि परिमाण qPCR द्वारा सहन उन लोगों की तुलना में अधिक के आदेशों 01:59 हैं बर्दाश्त करने में सक्षम है। ये लाभ EntHF183 dPCR परख विशेष रूप से आकर्षक है क्योंकि यह एक साथ दो अलग qPCR assays चलाने के लिए आवश्यकता के बिना पर्यावरण पानी में दोनों सामान्य और मानव-मल जुड़े संदूषण पर सटीक और repeatable जानकारी प्रदान करता है। qPCR पर अपने फायदे के बावजूद, वर्तमान में उपलब्ध उपकरण के साथ dPCR परख की ऊपरी सीमा की मात्रा का ठहराव लगभग परिमाण qPCR द्वारा प्राप्त की तुलना में कम है कि चार में से आदेश है। नतीजतन, इस तरह आम तौर पर कमजोर पड़ने सीवेज फैल निम्नलिखित मनाया उन लोगों के रूप में लक्ष्य जीवों की उच्च सांद्रता की माप के लिए की जरूरत है।

एक अच्छा EntHF183 द्वैध dPCR रन स्वीकार कर लिया बूंदों (सीए 10,000-17,000) और नकारात्मक और सकारात्मक बूंदों 7 के लिए प्रतिदीप्ति मूल्यों के बीच अपेक्षाकृत बड़े अंतर (सीए 5000) के अपेक्षाकृत उच्च संख?...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

यह पांडुलिपि एक डुप्लेक्स डिजिटल पीसीआर परख है कि एक साथ उदर एसपीपी यों इस्तेमाल किया जा सकता है। और मनोरंजन पानी में सामान्य और मानव-मल जुड़े संदूषण के संकेतक के रूप HF183 आनुवंशिक मार्करों का वर्णन है।

एक साथ मात्रा के लिए एक डुप्लेक्स डिजिटल पीसीआर परख<em&gt; उदर एसपीपी।</em&gt; और वाटर्स में मानव मल से जुड़े HF183 मार्कर

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

उच्च Throughput Microplate assays का उपयोग जल, मिट्टी, और तलछट में माइक्रोबियल कोशिकी एंजाइम गतिविधि का निर्धारण

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

वर्णमिति जांच के कागज आधारित<em&gt; कोलाई</em&gt;,<em&gt; साल्मोनेला</em&gt; एसपीपी., और<em&gt; लिस्टेरिया monocytogenes</em&gt; कृषि पानी की बड़ी मात्रा से

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

तटीय तलछट और -16 की मात्रा rRNA जीन और टेप से एक साथ डीएनए शाही सेना निकालना वास्तविक समय पीसीआर द्वारा

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

स्वच्छ सैम्पलिंग और ट्रेस धातु अध्ययन के लिए नदी और मुहाने जल का विश्लेषण

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

समुद्र सतह और नमूना विश्लेषण पर Microplastics सैम्पलिंग के लिए प्रोटोकॉल

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

प्लास्टिक छर्रों और प्लास्टिक प्रकार विश्लेषण से ऑगानोक्लोरीन कीटनाशकों का निकास

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

कॉफी बेरी बरमा की वैज्ञानिक निगरानी के लिए हवाई प्रोटोकॉल: कॉफी Agroecosystems के लिए एक मॉडल दुनिया भर में

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

नींबू के विशिष्ट और सटीक का पता लगाने हरियाली रोगज़नक़ कैंडिडेटस liberibacter एसपीपी. खट्टे पत्ती ऊतक के नमूनों पर पारंपरिक पीसीआर का प्रयोग

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

अम्ब्रोसिया बीटल, Platypus Quercivorus (मुरायामा) की उड़ान की क्षमता को मापने, एक कम लागत, छोटे, और आसानी से निर्माण उड़ान मिल का उपयोग

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

हत्यारा कीड़े और अंय Heteropteran कीड़ों से विष विषाक्त पदार्थों की कटाई

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...