Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. 분석 혼합물 준비 <ol><li> TE의 pH 8 버퍼에있는 모든 분자 수준의 물에 프라이머 및 프로브 [Entero F1A, Entero R1, GPL813TQ 12 100 μmol / L의 재고 농도를 확인; HF183-1, BthetR1, BthetP1 3]. 참고 :이 타겟 프로브는 형광 재료 / 장비 목록에 표시된 다른 형광 (7)으로 표시됩니다. </li><li> 계획 반응에 따라 혼합하여 12 μl의 디지털 PCR 믹스 마스터 믹스를 준비 0.216 ㎕를 앞으로 각 (배 ?...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

프로토콜에서 몇 가지 중요한 단계가 있습니다. 마스터 믹스 종래 qPCR의 마스터 믹스보다 점성이기 때문에 먼저, 분석 혼합물의 혼합은 어렵다. 간단한 텍싱 차례로 분석 혼합물에이어서 방울에 DNA 템플릿의 비 균일 한 분포로 연결 불충분 한 혼합, 발생할 수 있습니다. 프로토콜에 설명 된 혼합 별 피펫 팅 기술은 정확한 dPCR 정량을 보장하기 위해 따라야합니다. 둘째, 물방울이 균일 한 형태와 크...

들이보다 빠르고 유연하고 전통 문화 기반 방법에 비해 특정한 때문에 정량적 PCR (qPCR에) 방법이 널리 오락 수질 모니터링 및 미생물 소스 추적 애플리케이션에 사용되어왔다. 따라서, qPCR에이 같은 엔테로 종으로 일반 배설물 지표에 대한 신속한 물 모니터링 결과를 달성하는 것이 좋습니다. 개정 USEPA 레크리에이션 수질 기준 1. 대부분의 qPCR 분석은 개발 환경이 물에 분변 오염의 소스를 식별하기위한 검증되었다. 이들 중에서도 HF183 마커 분석은 가장 자주 인간 분변 오염 연관된 3 식별하는데 사용들이다. 그들이 정량 표준 곡선에 의존하기 때문에, qPCR의 결과는 종종 편향 될 수있다. qPCR에는 스탠에서 자신의 정량주기 (Cq와)를 보간하여 샘플 대상의 알 수없는 농도를 정량화Cq와와 직렬로 희석 된 표준 세트의 로그 양 사이에 선형 관계를 설명 바 닥 곡선. 안정적이고 일관된 표준 참조 물질의 부족 때문에 크게 qPCR에 결과를 바이어스 할 수 있습니다. 연구 qPCR의 결과가 서로 다른 공급 업체의 4에서 약 절반 로그 사용 기준에 차이와 같은 공급 업체 5 표준의 다른 배치를 사용하여 2 배에 의해 것으로 나타났다. 디지털 PCR (dPCR) 기술은 균일 한 나노 리터 또는 피코 리터 반응 6 수천 또는 수백만 벌크 qPCR의 분할에 의해 생성 된 소형 PCR들의 다수의 긍정의 빈도를 카운트하여 미지 시료를 정량화한다. 파티션이 물 유 방울 (즉,이 문서) 또는 칩에 작은 챔버 경우 그것은 각각 (즉,이 문서) 방울 디지털 PCR 또는 챔버 디지털 PCR로 언급된다. 높은 샘플 농도는 대상 DNA의 존재를 야기 할파티션의 높은 비율 (따라서 긍정적 인 PCR), 포아송 분포로 근사 관계. 이와 같이, 이진 결과 (양 또는 음 PCR)이 기록되어 포지티브 액적 주파수 qPCR에 같이 표준 곡선에 대한 필요성을 제거 직접 포아송 근사 통해 미지의 샘플 농도를 계산하는데 사용된다. 디지털 PCR 정량이 진 본성은 qPCR에 7 위에 추가 이점을 제공한다. 지연 증폭 여전히 양성 PCR을 수득 할 수 있기 때문에, dPCR 정량화는 증폭 효율을 감소 억제에 대해 더 강력하다. qPCR에 8 ~ 10에 비해 dPCR 높은 정밀도로 이어지는, qPCR에있다 마찬가지로, dPCR 정량이 된 CQ 값의 변동에 의해 영향을받지 않습니다. 또한, 분할 프로세스는 효과적으로 amplificatio 동안 (기판의 경쟁을 최소화하는 각 방울에 타겟 DNA에 존재하는 매우 소량 보장qPCR에에 (즉, 분석이 동시에 두 개의 DNA 목표를 측정) 양면 인쇄를 달성하기위한 일반적인 장애물 서로 다른 DNA 대상)의 n은. 따라서, 양면 또는 단면에 실행 (즉 하나의 대상이 하나의 분석에서 측정) 여부를 dPCR 모두 대상 7,11의 거의 구별 정량을 생산하고 있습니다. 이 문서에서 설명하는 디지털 PCR 분석 (EntHF183 dPCR)의 목표는 일반 배설물 표시 엔테로 종의 동시 직접 정량화를 얻을 수 있습니다. 향상된 정밀도, 재현성 및 억제에 대한 견고성과 인간 배설물 관련 HF183 마커는 qPCR에 비교 대응. 이 분석은 성공적 환경 담수, 해수 및 각종 분뇨 7 분변 오염의 정량을 위해 사용되었지만, 또한 물 및 폐수의 다른 유형에도 적용될 수있다. 이 분석은 때문에 그것을 퇴적물 또는 토양 분석을위한 큰 약속을 보유하고억제에 높은 내성을이야,하지만 억제제는 샘플의 이러한 종류의 혼합의 추가 시험 때문에 복잡성 요구된다.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

이 원고는 엔테로 종의 동시 정량. 인간 배설물 관련 HF183 마커에 대한 이중 디지털 PCR 분석 (EntHF183 dPCR)에 대해 설명합니다. EntHF183 이중 dPCR (EntHF183 dPCR로 함 이에 관해서) 분석은 공개 된 개별 정량 PCR (qPCR에) 대응과 같은 프라이머 및 프로브 시퀀스를 사용합니다. 마찬가지로, 이전 qPCR에 대해 수행과 같은 물 여과 및 DNA 추출 절차는 dPCR를 실행하기 전에 다음에 있습니다. 그러나, 이중 dPCR 분석은 qPCR에 분석을 통해 몇 가지 장점이 있습니다. 가장 중요한 dPCR 분석은 대상의 직접 정량화하여, 따라서 표준 곡선을 실행에 대한 필요성, 관련 바이어스 및 가변성을 제거합니다. qPCR에있는 (즉, 동시 정량) 엔테로 및 HF183를 양면 인쇄하는 동안뿐만 아니라, 종종 샘플 덜 풍부한 대상의 심각한 과소 평가로 연결, dPCR 두 목표의 일관성 정량을 제공하며, 자극그녀는 동일한 반응을 개별적으로 또는 동시에 정량. dPCR 분석도 qPCR에 의해 용인보다 높은 크기 1 ~ 2 오더이다 PCR 억제제의 농도를 허용 할 수있다. 그것은 동시에 두 개의 별도 qPCR에 분석을 실행할 필요없이 환경 바다에서 모두 일반과 인간의 관련 분변 오염에 대한 정확하고 반복 가능한 정보를 제공하기 때문에 이러한 장점은 EntHF183 dPCR 분석이 특히 매력적. qPCR에 이상 장점에도 불구하고, 현재 사용 가능한 장비와 dPCR 분석의 상부 정량 한계는 약 qPCR에 의한 달성보다 낮은 크기의 네 주문이다. 따라서, 희석 등의 일반적으로 하수 유출이 관찰 된 것과 대상 생물의 높은 농도의 측정을 위해 요구된다.

좋은 EntHF183 이중 dPCR 실행 허용 방울 (약 10,000-17,000) 및 음과 양의 물방울 7 형광 값 사이의 비교적 큰 차이 (약 5,000)의 상대적으로 높은 숫자가 발생한다. 방울의 수가 비정상적으로 낮은 가능성 액적 생성 공정에서 문제를 나타내고, 만 방울의 차단이 문서에서 사용되는 액적 dPCR 시스템으로부터 경험적 데이터에 기초하여 제시된다. 양극과 음극 방?...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

이 원고를 동시에 엔테로 종을 정량화하는 데 사용할 수있는 이중 디지털 PCR 분석. 레크리에이션 바다에서 일반과 인간의 관련 분변 오염의 지표로 HF183 유전자 마커를 설명합니다.

동시 정량을위한 이중 디지털 PCR 분석<em&gt; 엔테로 종.</em&gt;과 바다에서 인간 방패 관련 HF183 마커

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

높은 처리량 마이크로 분석 실험을 사용하여 워터스, 토양 및 퇴적물에있는 미생물 세포 외 효소 활성의 결정

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

연구

환경과학

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

색도계 탐지의 종이 기반의<em&gt; 대장균</em&gt;<em&gt; 살모넬라</em&gt; SPP., 그리고<em&gt; 리스테리아</em&gt; 농업 다량의 물에서

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

실시간 PCR에 의한 연안 퇴적물 및 정량 16S의 rRNA의 유전자 및 성적 증명서에서 동시 DNA-RNA 추출

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

클린 샘플링 및 추적 금속 연구 강 하구 바다의 분석

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

바다 표면 및 샘플 분석에 Microplastics 샘플링을위한 프로토콜

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

플라스틱 펠렛 및 플라스틱 유형 분석에서 유기 염소 농약의 추출

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

커피 베리 보어의 과학적 모니터링을 위한 하와이 프로토콜: 커피 Agroecosystems 전세계에 대 한 모델

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

특정 및 감귤 류 녹화 병원 체 Candidatus liberibacter 종 감귤 잎 조직 샘플에서 사용 하 여 기존의 PCR의 정확한 검출

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

저가, 소형, 그리고 쉽게 생성 된 비행 밀을 사용 하 여 신들의 딱정벌레, 오리너구리 Quercivorus (무라야마)의 비행 능력을 측정

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

독 독 소 암살자 버그와 다른 Heteropteran 곤충에서 수확

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...