Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Ensaio da preparação da mistura <ol><li> Faça concentrações 100 mmol / L de ações para todos os iniciadores em água de grau molecular e sondas em tampão TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Nota: Sondas para os dois alvos são fluorescente etiquetado com diferentes fluoróforos 7 como indicados na Lista de materiais / equipamentos. </li><li> Prepare mistura principal misturando, por reacção planejado, 12 ul digital de mistura d...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

Existem algumas etapas críticas do protocolo. Em primeiro lugar, a mistura das misturas de ensaio pode ser difícil, porque a mistura principal é mais viscoso do que misturas principais qPCR convencionais. vórtex simples pode levar a uma mistura insuficiente, o que conduz por sua vez à distribuição não uniforme de moldes de ADN nas misturas de ensaio e posteriormente nas gotículas. A técnica de mistura-por-pipetagem descrito no protocolo deve ser seguido para garantir a quantificação precisa dPCR. Em segundo ...

Os métodos quantitativos de PCR (qPCR) têm sido amplamente utilizados para a monitorização da qualidade da água de recreio e aplicações de monitorização de origem microbiana, porque eles são mais rápidos, mais flexível e específica em comparação com os métodos baseados em cultura tradicionais. Consequentemente, qPCR é recomendado para a obtenção de resultados de monitorização das águas rápidas para os indicadores fecais gerais, tais como Enterococcus spp. Nos critérios de qualidade revistos USEPA águas de recreio 1. Muitos ensaios qPCR também têm sido desenvolvidos e validados para a identificação de fontes de contaminação fecal em águas ambientais 2. Entre estes, os ensaios HF183 marcadores estão entre os mais utilizados para identificar a contaminação fecal associada a 3 humano. No entanto, os resultados qPCR muitas vezes pode ser tendenciosa, porque dependem de curvas padrão para a quantificação. qPCR quantifica concentrações desconhecidas do alvo em amostras por interpolação seu ciclo de quantificação (CQ) de um standard curva que descreve uma relação linear entre a quantidade Cq e logarítmica de um conjunto de padrões diluído seriadamente. Falta de material de referência confiável e consistente pode, portanto, viés bastante resultados qPCR. Estudos mostraram que os resultados qPCR diferiram em aproximadamente metade de um log usando padrões de diferentes fornecedores 4 e por 2 vezes utilizando diferentes lotes de padrões do mesmo fornecedor 5. A tecnologia digital PCR (dPCR) quantifica uma amostra desconhecida, contando a frequência de positivos em grande número de PCRs em miniatura que são gerados pelo particionamento de um qPCR em massa para milhares ou milhões de nanoliter uniforme ou reações picolitros 6. É referido como PCR gota digitais (isto é, neste artigo) ou PCR câmara digital de, respectivamente, se as divisórias são água-em-óleo de gotículas (isto é, neste artigo) ou pequenas câmaras sobre um chip. A concentração da amostra mais elevada resultará na presença de ADN alvo(PCR daí positiva), numa proporção superior das divisórias, uma relação aproximada pela distribuição de Poisson. Como tal, os resultados binários (PCR positiva ou negativa) são registados e a frequência de gotículas de positivos é usado para calcular as concentrações das amostras desconhecidas directamente através de Poisson aproximação, eliminando a necessidade de uma curva padrão como no qPCR. Esta natureza binária de quantificação PCR digital proporciona vantagens adicionais sobre qPCR 7. Uma vez que a amplificação atrasada pode ainda produzir um PCR positivo, dPCR quantificação seja mais robusto contra inibição que reduz a eficiência de amplificação. Da mesma forma, dPCR quantificação não é afectado pela variabilidade em valores Cq como é qPCR, levando a uma maior precisão da dPCR em comparação com 8-10 qPCR. Além disso, o processo de particionamento garante uma muito pequena quantidade de ADN presente alvo em cada gotícula, minimizando eficazmente competição pelo substrato (durante amplification de alvos diferentes de DNA) que são obstáculos comuns para alcançar duplex (ou seja, um ensaio mede simultaneamente dois alvos de ADN) em qPCR. Como tal, se executado em duplex ou simplex (ou seja, um alvo é medido em um único ensaio) dPCR produz quantificação quase indistinguível de ambos os alvos 7,11. O objetivo do ensaio de PCR digitais (EntHF183 dPCR) descrito neste artigo é a obtenção de quantificação direta simultânea do indicador fecal geral Enterococcus spp. E o marcador HF183 humano-fecal associada a uma melhor precisão, reprodutibilidade e robustez contra a inibição em comparação com seu qPCR homólogos. Este ensaio tem sido usado com sucesso para quantificar a contaminação fecal no ambiente de água doce, água do mar, e vários material fecal 7, mas também pode ser aplicado a quaisquer outros tipos de águas e águas residuais. Este ensaio é uma grande promessa para a análise de sedimentos ou solos devido a eles elevada tolerância à inibição, mas mais testes é necessária devido às complexidades de inibidor mistura nestes tipos de amostras.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Este manuscrito descreve um ensaio de PCR digitais duplex (EntHF183 dPCR) para a quantificação simultânea de Enterococcus spp. E o marcador HF183 fecal-associado humana. O EntHF183 duplex dPCR (referido como EntHF183 dPCR hereon) ensaio utiliza as mesmas sequências de Iniciador e Sonda como as suas congéneres PCR quantitativo (qPCR) individuais publicados. Da mesma forma, os mesmos procedimentos de filtragem de água e extração de DNA como realizados antes da qPCR são seguidos antes de executar dPCR. No entanto, o ensaio dPCR duplex tem várias vantagens sobre os ensaios de qPCR. Mais importante, o ensaio dPCR elimina a necessidade de execução de uma curva padrão e, por conseguinte, a polarização e variabilidade associada, por quantificação directa dos seus alvos. Além disso, embora a impressão duplex (isto é quantificação simultânea) Enterococcus e HF183 em qPCR muitas vezes leva a subestimação grave do alvo menos abundantes em uma amostra, dPCR fornece quantificação consistente de ambos os alvos, aguçarela quantificada individualmente ou simultaneamente na mesma reacção. O ensaio dPCR também é capaz de tolerar concentrações de inibidor de PCR que são uma a duas ordens de magnitude maior do que as toleradas por qPCR. Estas vantagens tornam o ensaio EntHF183 dPCR particularmente atraente porque fornece simultaneamente informações precisas e repetíveis em ambos contaminação geral e associada humano-fecal em águas ambientais, sem a necessidade de executar dois ensaios qPCR separadas. Apesar das suas vantagens sobre qPCR, o limite de quantificação do ensaio superior dPCR com instrumentação actualmente disponível é aproximadamente quatro ordens de grandeza menor do que a alcançável por qPCR. Por conseguinte, a diluição é necessário para a medição de concentrações elevadas de organismos alvo, tais como aqueles tipicamente observado após a derrames de esgoto.

Um bom EntHF183 duplex dPCR execução deve resultar em número relativamente elevado de gotículas aceites (cerca de 10,000-17,000) e diferença relativamente grande (cerca de 5,000) entre os valores de fluorescência para gotas negativos e positivos 7. Invulgarmente baixo número de gotículas provavelmente indica problemas no processo de geração de gotículas, e um limite de exclusão de 10.000 gotículas é sugerida com base em dados empíricos do siste...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Este manuscrito descreve um ensaio de PCR digital duplex que pode ser utilizado para quantificar simultaneamente Enterococcus spp. E os marcadores genéticos HF183 como indicadores de contaminação fecal humana em geral e associada-em águas de recreio.

Um ensaio de PCR Duplex Digital para a simultânea Quantificação da<em&gt; Enterococcus spp.</em&gt; Ea Human Fecal-associado HF183 marcador no Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Determinação da Microbial Extracelular Enzyme actividade nas águas, solos e sedimentos, utilizando alta taxa de transferência de microplaca Ensaios

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Ambiente

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Papel colorimétrico à base de Detecção de<em&gt; Escherichia coli</em&gt;,<em&gt; Salmonella</em&gt; Spp. E<em&gt; Listeria monocytogenes</em&gt; A partir de grandes volumes de água Agrícola

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

DNA-RNA simultânea de extração de sedimentos costeiros e quantificação de 16S rRNA genes e transcritos por PCR em tempo real

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Limpo Amostragem e Análise do Rio e Estuarina Waters de Estudos de metal de rastreamento

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Protocolo para Microplásticos Amostragem na superfície do mar e análise de amostras

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Extração de Pesticidas Organoclorados de Pelotização de Plástico e Análise de Tipo de Plástico

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

O protocolo de Havaí para acompanhamento científico da broca do café: um modelo para agroecossistemas de café no mundo

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Específicos e detecção precisa do Using PCR convencional em amostras de tecido de folhas cítricas cítricas Greening patógeno Candidatus liberibacter spp.

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Medir a capacidade de voo do besouro Ambrosia, ornitorrinco Quercivorus (Murayama), usando um baixo custo, pequeno e voo facilmente construído moinho

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Colheita de toxinas de veneno de barbeiros e outros insetos Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...