Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Анализ смеси Приготовление <ol><li> Сделать концентрации 100 мкмоль / л запаса для всех праймеров в классе воды молекулярной и зондов в ТЕ рН 8 буфере [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Примечание: Зонды для двух целей флуоресцентно помечены различными флуорофоров 7...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

Есть несколько важных шагов в протоколе. Во-первых, смешивание пробирного смесей может быть затруднено, так как основной смеси, включающей более вязкая, чем обычные мастер-смесей КПЦР. Простой вортексе может привести к недостаточному перемешиванию, которое, в свою очередь, приводит к н?...

Количественные ПЦР (КПЦР) методы широко используются для рекреационного мониторинга качества воды и микробных отслеживания приложений источник, потому что они быстрее, более гибкими и специфичным по сравнению с традиционными методами культивирования на основе. Следовательно, КПЦР рекомендуется для достижения быстрых результатов мониторинга воды для общих фекальных показателей , таких как Enterococcus SPP. В пересмотренных USEPA критериев качества воды в рекреационных целях 1. Многие анализы КПЦР также были разработаны и утверждены для выявления источников фекального загрязнения окружающей среды в водах 2. Среди них HF183 маркер анализы являются одними из наиболее часто используемых для идентификации фекальное загрязнение человеческого ассоциированного 3. Тем не менее, результаты КПЦР часто могут быть неточными, так как они опираются на стандартные кривые для количественной оценки. КПЦР квантифицирует неизвестные концентрации мишени в образцах путем интерполяции их количественного определения цикла (Cq) из Стандардскую кривая, которая описывает линейную зависимость между Cq и логарифмическим количеством набора серийно разведенной стандартов. Поэтому отсутствие надежного и последовательного стандартного эталонного материала может значительно смещают результаты КПЦР. Исследования показали , что результаты КПЦР отличались примерно на половину длины бревне эталони- от различных поставщиков 4 и 2 раза с использованием разных порций стандартов от того же поставщика 5. Цифровые технологии ПЦР (ДПСП) квантифицирует неизвестного образца путем подсчета частоты позитива в большом количестве миниатюрных ДЗП, которые создаются путем разделения насыпную КПЦР на тысячи или миллионы равномерной nanoliter или пиколитра реакций 6. Это называется , как капельной цифровой ПЦР (то есть, в этой статье) или камере цифровой ПЦР, соответственно, если Перегородки вода-в-масле капли (то есть, в этой статье) или небольшие камеры на чипе. Более высокая концентрация образца будет приводить к наличию ДНК-мишени(Следовательно, положительная ПЦР) в большей пропорции, перегородок, отношения аппроксимируется распределением Пуассона. Таким образом, бинарные результаты (положительный или отрицательный ПЦР) регистрируются и частота положительных капель используется для расчета неизвестных концентраций исследуемого образца непосредственно с помощью приближения Пуассона, устраняя необходимость в стандартной кривой, как в кПЦР. Этот бинарный характер цифровой ПЦР количественной оценки дает дополнительные преимущества по сравнению с кПЦР 7. Поскольку задержка амплификации еще может дать положительный результат ПЦР, ДПСП Количественное является более устойчивым по отношению к торможению, что снижает эффективность амплификации. Точно так же, ДПСП Количественное не зависит от изменчивости значений Cq как КПЦР, что приводит к более высокой точности по сравнению с ДПСП кПЦР 8-10. Кроме того, процесс разделения обеспечивает очень небольшое количество ДНК, присутствующей мишени в каждой капельке, эффективно сводя к минимуму конкуренцию субстрата (в течение amplificatioп различных мишеней ДНК) , которые являются общими препятствия на пути достижения дуплексную (т.е. анализа одновременно измеряет две мишени ДНК) в кПЦР. Таким образом , работать в дуплексном или симплекс (т.е. одна цель измеряется в одном анализе) ли ДПСП производит почти неотличимы квантификацию обоих мишеней 7,11. Целью цифровой ПЦР (EntHF183 DPCR) , описанной в этой статье , чтобы получить одновременное прямое количественное определение общего фекального индикатора Enterococcus SPP. , А человек-фекальные связанный HF183 маркер с улучшенной точностью, воспроизводимости и устойчивости к ингибированию по сравнению с его кПЦР двойники. Этот анализ был успешно использован для количественного определения фекального загрязнения в окружающей пресной воды, морской воды, а также различные фекального материала 7, но также могут быть применены к любым другим типам вод и сточных водах. Этот анализ имеет большие перспективы для анализа отложений или почв из-за негоS высокая толерантность к торможению, но дальнейшее тестирование требуется из-за сложностей ингибитора смесей в этих типах образцов.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Эта рукопись описывает дуплексный цифровой ПЦР (EntHF183 ДПСП) для одновременного количественного определения Enterococcus SPP. И человека фекально-ассоциированной HF183 маркером. EntHF183 дуплекс ДПСП (называемый также EntHF183 ДПСП на этом) анализе используют одни и те же последовательности праймеров и зондов в качестве своих опубликованных индивидуальных количественной ПЦР (КПЦР) экземплярах. Точно так же, те же фильтрации воды и экстракции ДНК процедуры, выполняемые до кПЦР следуют до запуска ДПСП. Тем не менее, дуплекс ДПСП анализ имеет ряд преимуществ по сравнению с КПЦР анализов. Наиболее важно то, что анализ ДПСП устраняет необходимость запуска стандартной кривой, и, следовательно, связанный с ним смещение и изменчивость, путем прямой количественной оценки своих целей. Кроме того, в то время как дуплексной (т.е. одновременное количественное) Enterococcus и HF183 в кПЦР часто приводит к сильному занижению менее обильной мишени в образце, ДПСП обеспечивает последовательное количественное определение обеих целей, подогретьее количественно по отдельности или одновременно в той же самой реакции. Анализ ДПСП также способен переносить концентрации ингибитора ПЦР, которые один-два порядка выше, чем терпимо кПЦР. Эти преимущества делают анализ EntHF183 ДПСП особенно привлекательным, поскольку он одновременно обеспечивает точную и воспроизводимую информацию как общего и человеческого ассоциированных фекального загрязнения окружающей среды в водах без необходимости запуска двух отдельных анализов КПЦР. Несмотря на свои преимущества по сравнению с кПЦР, верхний предел количественного анализа анализа ДПСП с имеющихся в настоящее время приборов примерно на четыре порядка ниже, чем достижимо кПЦР. Следовательно, разбавление необходим для измерения высоких концентраций организмов-мишеней, таких как те, которые обычно наблюдаются следующие канализационные разливы.

Хороший пробег EntHF183 дуплекс ДПСП должно приводить к относительно большое количество принятых капель (приблизительно 10,000-17,000) и относительно большой разницы (около 5000) между значениями флуоресценции для отрицательных и положительных капель 7. Необычно...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Эта рукопись описывает дуплексный цифровой анализ ПЦР , который может использоваться для одновременного количественного определения Enterococcus SPP. И HF183 генетические маркеры , как показатели общего и человеческого ассоциированного фекального загрязнения в рекреационных водах.

Дуплексной связи с цифровой ПЦР-анализ для одновременного Количественное определение<em&gt; Enterococcus SPP.</em&gt; И человеческая Фекальные-ассоциированный HF183 Marker в водах

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Определение микробной внеклеточной ферментативной активности в вод, почв и донных отложений с использованием высокой пропускной MICROPLATE Анализы

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Колориметрический бумажной основе Обнаружение<em&gt; Кишечная палочка</em&gt;,<em&gt; Сальмонелла</em&gt; SPP., И<em&gt; листерий</em&gt; Из больших объемов воды для сельского хозяйства

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Одновременная ДНК-РНК Извлечение из прибрежных отложений и Количественная 16S-рРНК и транскриптов с помощью ПЦР в реальном времени

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Чистый отбор проб и анализ реки и эстуарии для изучения следов металлов

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Протокол Microplastics Отбор проб на поверхности моря и анализа проб

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Экстракция органохлоридных пестицидов из пластиковых гранул и анализ пластического типа

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

Гавайи протокол для научного мониторинга кофе Берри Борер: модель для кофе агроэкосистем во всем мире

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Конкретные и точного обнаружения цитрусовых озеленение возбудителя Candidatus liberibacter spp. Использование обычных ПЦР на цитрусовые образцы тканей листа

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Измерение способности полета Амброзия жука, Quercivorus Утконос (Мураяма), используя лоу кост, небольшой и легко построены полета мельница

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Заготовка Venom токсины от убийца ошибок и других насекомых, Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...