Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Ensayo de la preparación de mezclas <ol><li> Hacer concentraciones de 100 mmol / L de existencias para todos los cebadores en el agua de grado molecular y sondas en TE pH 8. [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Nota: Las sondas para los dos objetivos se marcaron con fluorescencia diferentes fluoróforos 7, como se indica en la Lista de Materiales / Equipos. </li><li> Preparar la mezcla maestra mezclando, por reacción planificada, 12 l digital d...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

Hay unos pocos pasos críticos en el protocolo. En primer lugar, la mezcla de las mezclas de ensayo puede ser difícil porque la mezcla maestra es más viscoso que las mezclas convencionales maestros qPCR. agitación simple puede conducir a una mezcla insuficiente, que a su vez conduce a una distribución no uniforme de moldes de ADN en las mezclas de ensayo y, posteriormente, en las gotitas. La técnica de mezcla por pipeteado se describe en el protocolo se debe seguir para asegurar la cuantificación precisa dPCR. En ...

Los métodos cuantitativos de PCR (qPCR) han sido ampliamente utilizados para el seguimiento de recreo calidad del agua y aplicaciones de seguimiento de fuente microbiana porque son más rápidos, más flexible y específica en comparación con los métodos tradicionales basadas en el cultivo. En consecuencia, la qPCR se recomienda para lograr rápidos resultados de monitoreo de aguas fecales para los indicadores generales, tales como Enterococcus spp., En los criterios de calidad del agua recreativa USEPA 1 revisado. Muchos ensayos de qPCR también se han desarrollado y validado para la identificación de las fuentes de contaminación fecal en las aguas ambientales 2. Entre estos, los ensayos de marcadores HF183 se encuentran entre los más utilizados para la identificación de la contaminación fecal humana asociada-3. Sin embargo, los resultados qPCR a menudo pueden estar sesgados porque se basan en las curvas de calibración para la cuantificación. qPCR cuantifica concentraciones desconocidas de diana en las muestras por interpolación de su ciclo de cuantificación (CQ) de un stancurva Dard que describe una relación lineal entre Cq y cantidad logarítmica de un conjunto de patrones diluidos en serie. Por lo tanto, la falta de material de referencia estándar fiable y consistente puede sesgar en gran medida los resultados qPCR. Los estudios demostraron que qPCR resultados diferían usando patrones de aproximadamente la mitad de un registro de diferentes proveedores 4 y 2 veces usando diferentes lotes de normas del mismo vendedor 5. La tecnología digital de PCR (dPCR) cuantifica una muestra desconocida contando la frecuencia de casos positivos en un gran número de informes de terminación en miniatura que se generan mediante la partición de la PCR cuantitativa a granel en miles o millones de nanolitros uniforme o reacciones picolitros 6. Se hace referencia como PCR gotita digital (es decir, en este artículo) o cámara de PCR digital, respectivamente, si las particiones son gotitas de agua-en-aceite (es decir, este artículo) o pequeñas cámaras en un chip. Una concentración de la muestra mayor resultará en presencia de ADN diana(PCR, por tanto, positiva) en una mayor proporción de particiones, una relación aproximada por distribución de Poisson. Como tal, los resultados binarios (PCR positivo o negativo) se registran y la frecuencia de las gotitas de positivos se utiliza para calcular las concentraciones de muestras desconocidas directamente a través de Poisson aproximación, eliminando la necesidad de una curva estándar como en qPCR. Esta naturaleza binaria de la cuantificación de PCR digital proporciona ventajas adicionales sobre qPCR 7. Debido a que la amplificación retrasado todavía puede producir una PCR positiva, dPCR cuantificación es más robusto frente a la inhibición que reduce la eficiencia de amplificación. Del mismo modo, dPCR cuantificación no se ve afectada por la variabilidad en valores Cq como es qPCR, lo que aumenta la precisión de dPCR comparación con qPCR 8-10. Además, el proceso de partición asegura una muy pequeña cantidad de ADN diana presente en cada gota, minimizando efectivamente la competencia sustrato (durante amplification de diferentes dianas de ADN) que son obstáculos comunes para lograr la impresión a doble cara (es decir, un ensayo mide simultáneamente dos dianas de ADN) en la qPCR. Como tal, si carrera en duplex o simplex (es decir, un objetivo se mide en un único ensayo) dPCR produce cuantificación casi indistinguibles de los dos objetivos de 7,11. El objetivo del ensayo de PCR digital (EntHF183 dPCR) descrito en este artículo es obtener cuantificación directa simultánea del indicador fecal general de Enterococcus spp. Y el marcador HF183-humano fecal asociada con una mayor precisión, reproducibilidad y robustez frente a la inhibición en comparación con su qPCR homólogos. Este ensayo ha sido utilizado con éxito para la cuantificación de la contaminación fecal en agua dulce del medio ambiente, el agua marina, y diversos materiales fecal 7, pero también puede ser aplicado a cualquier otro tipo de aguas y aguas residuales. Este ensayo representa una gran promesa para el análisis de los sedimentos o suelos debido a sus alta tolerancia a la inhibición, pero se necesitan más pruebas debido a la complejidad de inhibidor se mezcla en este tipo de muestras.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Este manuscrito describe un ensayo de PCR duplex digitales (EntHF183 dPCR) para la cuantificación simultánea de Enterococcus spp. Y el marcador HF183-fecal asociada humano. El EntHF183 dúplex dPCR (denominado en adelante como EntHF183 dPCR) ensayo utiliza las mismas secuencias de cebadores y sondas como sus homólogos individuales publicados por PCR cuantitativa (qPCR). Del mismo modo, las mismas de filtración de agua y extracción de ADN procedimientos que se realiza antes de la qPCR se siguen antes de ejecutar dPCR. Sin embargo, el ensayo dPCR duplex tiene varias ventajas sobre los ensayos de qPCR. Lo más importante, el ensayo dPCR elimina la necesidad para el funcionamiento de una curva estándar y, por tanto, el sesgo y la variabilidad asociada, mediante la cuantificación directa de sus objetivos. Además, mientras que a doble cara (es decir, la cuantificación simultánea) Enterococcus y HF183 en qPCR a menudo conduce a una subestimación grave del objetivo menos abundantes en una muestra, dPCR proporciona cuantificación coherente de ambos objetivos, amolasu cuantificó individualmente o simultáneamente en la misma reacción. El ensayo dPCR también es capaz de tolerar concentraciones de inhibidor de PCR que son de uno a dos órdenes de magnitud mayores que las toleradas por qPCR. Estas ventajas hacen que el ensayo EntHF183 dPCR particularmente atractivo, ya que al mismo tiempo proporciona información precisa y repetible en tanto la contaminación fecal general y asociada humano en aguas ambientales sin la necesidad de ejecutar dos ensayos de qPCR separadas. A pesar de sus ventajas sobre qPCR, el límite de cuantificación superior del ensayo dPCR con instrumentación disponible actualmente es de aproximadamente cuatro órdenes de magnitud más baja que la que puede conseguirse por qPCR. En consecuencia, se necesita dilución para la medición de altas concentraciones de organismos diana tales como los observados típicamente siguiente derrames de aguas residuales.

Un buen centro EntHF183 duplex dPCR debe dar lugar a relativamente alto número de gotitas aceptados (ca. 10,000-17,000) y diferencia relativamente grande (ca. 5000) entre los valores de fluorescencia para las gotitas de negativos y positivos 7. Inusualmente bajo número de gotitas probablemente indica problemas en el proceso de generación de las gotas, y un punto de corte de 10.000 gotitas se sugiere a partir de datos empíricos del sistema dPCR gotita util...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Este manuscrito describe un ensayo de teléfono digital de dos PCR que se puede utilizar para cuantificar simultáneamente Enterococcus spp. Y los marcadores genéticos HF183 como indicadores de contaminación fecal general y asociada a humanos en aguas de recreo.

Un ensayo de PCR digital de dos vías para la cuantificación simultánea de la<em&gt; Enterococcus spp.</em&gt; Y el marcador asociado HF183-fecal humana en las aguas

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Determinación de la actividad enzimática extracelular microbiana en aguas, suelos y sedimentos de los que utilizan y alto rendimiento de microplacas Ensayos

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Investigación

Medio ambiente

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimétrico Papel a base de Detección de<em&gt; Escherichia coli</em&gt;,<em&gt; Salmonella</em&gt; Spp,. Y<em&gt; Listeria monocytogenes</em&gt; De grandes volúmenes de agua en la agricultura

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

ADN-ARN simultánea extracción de los sedimentos costeros y cuantificación de 16S rRNA genes y las transcripciones de PCR en tiempo real

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Limpia Muestreo y Análisis de río y estuarios, aguas de trazas metálicas Estudios

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Protocolo para microplásticos muestreo en la superficie del mar y Análisis de las muestras

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Extracción de plaguicidas organoclorados de pellets de plástico y análisis de tipos de plástico

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

El protocolo de Hawaii para el seguimiento científico de la broca del café: un modelo para los agroecosistemas de café en todo el mundo

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Específica y detección precisa de los Citrus Greening patógeno Candidatus liberibacter spp mediante PCR convencional en muestras de tejido de hoja de Citrus

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Medición de la capacidad de vuelo del escarabajo de ambrosía, Platypus Quercivorus (Murayama), con un bajo costo, pequeño y vuelo fácilmente construido molino

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Recolección de las toxinas del veneno de insectos asesinos y otros insectos Heteropteran

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...