Name: a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters
Uploaded: 2016-03-09T13:00:00
Description: Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

The authors have no acknowledgements.

1. Deney karışımı hazırlanması <ol><li> TE pH 8 tamponu tüm moleküler sınıf su içinde primer ve prob [Entero F1A, Entero R1, GPL813TQ 12 100 mol / L stok konsantrasyonları olun; HF183-1, BthetR1, BthetP1 3]. Not: iki hedef için sondalar floresan Malzemeleri / Ekipman Listesinde belirtildiği gibi farklı fluorophores 7 ile etiketlenir. </li><li> Planlı reaksiyon başına, karıştırarak 12 ul dijital PCR karışımı master karışımı hazırlayın, 0.216 ul iler...

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

protokolde birkaç kritik adımlar vardır. Ana Karışım, geleneksel qPCR ana karışımları daha viskoz olduğundan ilk deney karışımları karıştırılması zor olabilir. Basit vorteksleme da deney karışımları ve daha sonra damlacıklar DNA şablonları eşit olmayan dağılımına neden olur yeterli karıştırma, neden olabilir. protokol açıklanan karıştırma-by-pipetleme tekniği doğru dPCR ölçümünü sağlamak için takip edilmelidir. İkinci olarak, damlacıklar tek yapılı bir şekle ve boyut...

daha hızlı, daha esnek ve geleneksel kültür temelli yöntemlerle karşılaştırıldığında özel çünkü kantitatif PCR (qPCR) yöntemleri yaygın eğlence su kalitesi izleme ve mikrobiyal kaynak takibi uygulamalarında kullanılmaktadır. Sonuç olarak, qPCR gibi Enterococcus spp gibi genel fekal göstergeler için hızlı su izleme sonuçları elde etmek için tavsiye edilir. Revize USEPA eğlence su kalite kriterleri 1. Birçok qPCR deneyleri de geliştirilmiş ve çevresel sularda 2 fekal kontaminasyon kaynaklarının belirlenmesi için onaylanmıştır. Bunlar arasında, HF183 işaretleyici deneyleri en sık insan ilişkili fekal kontaminasyonu 3 tanımlamak için kullanılan arasındadır. onlar ölçümü için standart eğriler güveniyor Ancak, qPCR sonuçlar genellikle önyargılı olabilir. qPCR bir stan kendi ölçümü döngüsünü (Cq) enterpolasyonlayarak örneklerinde hedefin bilinmeyen konsantrasyonlarını rakamlarlaCq ve seri seyreltilmiş standartların bir dizi logaritmik miktarı arasında doğrusal bir ilişki açıklanır dart eğrisi. güvenilir ve tutarlı standart referans malzeme eksikliği dolayısıyla büyük ölçüde qPCR sonuçlarını taraflı olabilir. Çalışmalar qPCR sonuçları farklı satıcılardan 4 yaklaşık yarım günlük kullanarak standartlarına göre farklılık ve aynı satıcıdan 5&#39;ten standartların farklı toplu kullanarak 2 kat ile gösterdi. Dijital PCR (dPCR) teknolojisi üniforma Nanoliter veya pikolitrelik reaksiyonlar 6 binlerce ya da milyonlarca içine toplu qPCR bölümleme tarafından oluşturulan minyatür PCR&#39;ler çok sayıda pozitif sıklığını sayarak bilinmeyen bir örnek rakamlarla. Bölmeler-içinde-su yağ damlacıkları (örneğin, bu makale) ya da çip küçük fonksiyonlu odalar olması durumunda bu, sırası ile (yani, bu makale) damlacık dijital PCR veya odası, dijital PCR olarak ifade edilir. Daha yüksek bir Örnek konsantrasyonu hedef DNA&#39;nın mevcudiyetinde sonuçlanırbölümleri daha yüksek bir oranda (dolayısıyla pozitif PCR), Poisson dağılımı ile yaklaştırılır bir ilişki. Bu nedenle, ikili sonuçlar (pozitif ya da negatif PCR) kaydedilir ve pozitif damlacıkların frekansı qPCR olarak standart bir eğri olan ihtiyacı ortadan kaldırarak, doğrudan Poisson yaklaşım ile bilinmeyen numune konsantrasyonları hesaplamak için kullanılır. Dijital PCR nicelikleme Bu ikili doğası qPCR 7 üzerinde ek avantajlar sağlamaktadır. gecikmiş amplifikasyon hala olumlu bir PCR sağlayabilir, çünkü dPCR miktar amplifikasyon verimliliği azaltır inhibisyonuna karşı daha sağlamdır. QPCR 8-10 göre dPCR yüksek hassasiyet yol qPCR olarak Benzer şekilde, dPCR miktar Cq değerleri değişkenlik etkilenmez. Buna ek olarak, bölme işlemi etkin bir şekilde amplificatio sırasında (alt-tabaka rekabet en aza indirerek, her damla hedef DNA mevcut çok az miktarda sağlanırqPCR (yani bir tahlil aynı anda iki DNA hedefleri ölçen) duplekslemeyi ulaşmak için ortak engeller farklı DNA hedefleri) n. Bu nedenle, dubleks veya simpleks çalışma (yani bir hedef, tek bir deneyde ölçülen) olmadığını dPCR her iki hedeflerin 7,11 neredeyse ayırt edilemez miktarının üretir. Bu makalede açıklanan dijital PCR deneyi (EntHF183 dPCR) amacı, genel dışkı göstergesi Enterococcus spp Eş zamanlı miktarının elde etmektir. Ve geliştirilmiş hassasiyet, tekrarlanabilirlik ve inhibisyonuna karşı sağlamlığı olan insan dışkı ilişkili HF183 markör olarak qPCR karşılaştırıldığında uzantılarıdır. Bu deney, başarılı bir şekilde, çevresel tatlı su, deniz suyu ve çeşitli dışkı maddesinin 7 dışkı kirlenme ölçülmesi için kullanılmıştır, ama aynı zamanda suları ve atık suların bir diğer türlerine de uygulanabilir. Bu tahlil, kendisine bağlı tortuları veya topraklar analiz etmek için büyük söz sahibidirinhibisyonuna yüksek tolerans s, ancak inhibitör örnekleri, bu tür karışımlar daha fazla test için karmaşıklığı gereklidir.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Bu yazının Enterococcus spp eşzamanlı ölçümü. Ve insan fekal-ilişkili HF183 işaretleyici için bir dubleks dijital PCR testi (EntHF183 dPCR) açıklar. EntHF183 dubleks dPCR (EntHF183 dPCR olarak anılacaktır buradan sonra) deneyi yayınlanmış bireysel kantitatif PCR (qPCR) meslektaşlarıyla aynı primer ve prob dizileri kullanır. Aynı şekilde, önce qPCR uygulandı aynı su filtreleme ve DNA ekstraksiyon prosedürleri dPCR çalıştırmadan önce takip edilmektedir. Ancak, dubleks dPCR tahlil qPCR deneyleri üzerinde birçok avantajı vardır. En önemlisi, dPCR tahlil hedefleri doğrudan ölçümü ile dolayısıyla standart bir eğri çalışan ve ihtiyacını, ilgili önyargı ve değişkenliği, ortadan kaldırır. QPCR (yani eşzamanlı kantifikasyon) enterokokların ve HF183 arkalı önlü ise ek olarak, çoğu kez bir numunede daha az bol hedefin ciddi küçümsenmesi yol açar, dPCR hem hedeflerin tutarlı ölçümü sağlar, uyandırmakona aynı reaksiyonda eş zamanlı olarak tek başına ya da miktarı. dPCR deneyi de qPCR tolere daha yüksek büyüklükte bir ya da iki emirler PCR inhibitörü konsantrasyonları tolere edebilmektedir. aynı anda iki ayrı qPCR deneyleri çalıştırmak için gerek kalmadan çevre sularda hem genel hem de insan-ilişkili fekal kontaminasyon doğru ve tekrarlanabilir bilgi sağlar, çünkü bu avantajlar EntHF183 dPCR tahlil özellikle çekici olun. qPCR üzerindeki avantajlara rağmen, şu anda mevcut cihaz olan dPCR deneyinde üst miktar sınırı yaklaşık qPCR elde edilebilenden daha düşük bir magnitüd dört işlemlerdir. Sonuç olarak, seyreltme, tipik pis su sızıntıları ardından gözlenen hedef organizmaların yüksek konsantrasyonlarının ölçümü için gereklidir.

İyi bir EntHF183 dupleks dPCR çalıştırma kabul damlacıklar (yaklaşık 10,000-17,000) ve negatif ve pozitif damlacıklar 7 floresans değerleri arasında nispeten daha büyük bir fark (yaklaşık 5.000) nispeten yüksek sayıda neden olmalıdır. damlaların alışılmadık az sayıda büyük olasılıkla damlacık oluşturma sürecinde sorunları gösterir ve 10.000 damlacıkların bir kesim bu makalede kullanılan damlacık dPCR sisteminden ampirik v...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Bu yazıda, aynı anda Enterococcus spp ölçmek için kullanılabilecek bir çift yönlü dijital PCR deneyi. Ve eğlence sularda genel olarak insan ilişkili dışkı kirlenme göstergeleri olarak HF183 genetik işaretleyiciler açıklanmaktadır.

Eşzamanlı Niceleme için Dubleks Dijital PCR Testi<em&gt; Enterococcus spp.</em&gt; Ve Waters İnsan Fekal ilişkili HF183 Marker

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Yüksek Verimli Mikroplate Tahliller kullanarak Waters, Topraklar ve tortulları Mikrobiyal Ekstrasellüler Enzim Aktivitesi Belirlenmesi

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

Kolorimetrik Algılama Paper-based<em&gt; Escherichia coli</em&gt;<em&gt; Salmonella</em&gt; Spp. Ve<em&gt; Listeria monocytogenes</em&gt; Tarım Su geniş hacimli

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Gerçek zamanlı PCR ile Kıyı tortulları ve Niceleme 16S rRNA Genler ve Transkriptler eşzamanlı DNA-RNA Ekstraksiyon

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Temiz Örnekleme ve Eser Metal Çalışmaları Nehri ve haliç Waters Analizi

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Deniz Yüzey ve Numune Analizi Microplastics Örnekleme Protokolü

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastik Peletlerden Organochlorine Pestisitlerin Çıkarılması ve Plastik Tipi Analizi

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

The Hawaii Protocol for Scientific Monitoring of Coffee Berry Borer: a Model for Coffee Agroecosystems Worldwide

Bilimsel kahve Berry matkap izleme Hawaii Protokolü: bir Model için kahve Agroecosystems dünya çapında

Coffee berry borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol that is aimed at ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Belirli ve narenciye Greening patojen olan liberibacter spp. kullanma geleneksel PCR narenciye yaprak doku örnekleri üzerinde doğru tespiti

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

Ambrosia Beetle, Platypus Quercivorus (Murayama), ucuz, küçük ve kolayca inşa uçuş Mill kullanarak uçuş yeteneği ölçme

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Venom toksinlerin Assassin böcek ve diğer Heteropteran böcekler hasat

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...