Name: induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)
Uploaded: 2016-03-25T13:00:00
Description: Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

ونود أن تكريم الراحل الدكتور بول ه باترسون لإسهاماته في تقدم نموذج MIA، والتوحد، والبحوث الفصام. ونحن نعترف سركيس ك Mazmanian على دعمه الكبير على هذا البروتوكول. روبن م بايون، وإيفيت غارسيا فلوريس، كارين جيم Lencioni، وليزلي نيومان A. للحصول على المساعدة الإدارية؛ علي Khoshnan ويان جيم كو للمساعدة على تصوير. إلين Y. هسياو وناتاليا Malkova للحصول على المشورة على MIA الاستقراء. جيفري كوكرين، خواكين جوتيريز، كوان واو لي، خايمي رودريجيز، لورينا جيم ساندوفال، وناتالي A. فيردوزكو لتربية الحيوانات الخبراء الخاصة بهم. وأيد هذا العمل من قبل جائزة المعاهد الوطنية للصحة كونتي مركز (NIH 5P50MH086383-04، إلى بول ه باترسون)؛ التوحد يتحدث (# 7670، إلى بول ه باترسون)؛ مؤسسة سيمونز (# 322839، سركيس ك Mazmanian)؛ المعاهد الوطنية للصحة تدريب جرانت (NIH / NRSA T32GM07616 لك-HC)؛ معهد كاليفورنيا للتكنولوجيا الصيفية الجامعية زمالة أبحاث (SURF) (لZY)؛ أمجين برنامج المنح الدراسية في معهد كاليفورنيا للتكنولوجيا (لZY)؛ والاب زمالة بعد الدكتوراةمجلس أوم الوطنية للعلوم، تايوان (NSC 101-2917-I-564-039، إلى دبليو-LW).

وأجريت جميع البروتوكولات بموجب موافقة من معهد كاليفورنيا للجنة رعاية واستخدام الحيوان المؤسسي التكنولوجيا (IACUC). 1. التحضير للأزواج موقوت التزاوج <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام لا يقل عن 6 سدود للتجارب ?...

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

MIA الحث على نوافذ زمنية مختلفة، يشوش الأحداث نمو المخ المختلفة في القوارض، وبالتالي يؤدي إلى تشوهات وneuropathologies سلوكية مختلفة في النسل. هنا، وصفنا بروتوكول للحث وزارة الداخلية في الفئران مع بولي (I: C) الحقن في E12.5. هذا الأسلوب من MIA تحريض يؤدي إلى السلوكية والعصبية، المن?...

مفهوم التنشيط المناعي للأم (MIA) تنبع من الدراسات الوبائية على جمعية إصابة الأم بمرض التوحد وانفصام الشخصية 1. نظرا لعدم وجود مسببات الأمراض الفيروسية تكرار اكتشافها في المشيمة أو دماغ الجنين بعد عدوى فيروسية الأمهات 2،3، على فرضية تأثير الإصابة على ذرية أن يكون سبب تنشيط الجهاز المناعي للأم بدلا من مسببات الأمراض أنفسهم . لإلقاء الضوء على العلاقة بين السبب والنتيجة بين وزارة الداخلية والاضطرابات النفسية، حقن تصنيعه كيميائيا، الفيروسية تقليد ضعف polyinosinic الحمض النووي الريبي RNA: حمض polycytidylic (بولي (I: C)) في القوارض الحوامل قد استخدمت على نطاق واسع في نموذج حيواني لMIA 4،5. ومن المسلم: (C I) التي تشبه عدد مستقبلات 3 (TLR3)، والإدارة الشاملة للبولي (I: C) بولي يدفع الفيروسية مثل الاستجابة الالتهابية الحادة. واحدة من الآليات التي بولي (I: C) العلاقات العامةالعامة oduces تشوهات وneuropathologies السلوكية في النسل هي التي تسبب اختلالا السيتوكينات الالتهابية المؤيدة والمناهضة في محور الأم والمشيمة، الجنين 6. وقد تبنت عدة مجموعات نموذج MIA لفهم مسببات الاضطرابات النفسية 7، ويرجع ذلك إلى المصالح المتنوعة بين المجموعات البحثية، وقد استخدمت نقاط زمنية مختلفة من تنشيط جهاز المناعة لتحقيق اضطرابات مختلفة على نمو الدماغ والسلوكيات 7. المختبر بول ه باترسون في معهد كاليفورنيا للتكنولوجيا يتبنى استراتيجية حقن بولي (I: C) في الفئران الحوامل في الجنينية 12.5 يوما (E12.5)، الذي أثبت بنجاح أن وزارة الداخلية غير قادرة على إحداث السلوكية والعصبية، والتغيرات المناعية في النسل التي ترتبط مع مرض التوحد والفصام 8-11. تظهر أعمالنا السابقة التي MIA ذرية عرض الانحرافات السلوكية (على سبيل المثال، impairmen الاجتماعيةر، العجز الاتصالات، وتكرار السلوك، والسلوك للقلق مثل، والكامنة العجز تثبيط 8،10،12)، المناعي التقلبات والسيتوكينات الخلل 8،13،14، تغيير الجنين التعبير الجيني الدماغ 15، وفقدان الخلايا العصبية في فصيص السابع المخيخ 11، تغيير خصائص متشابك في قرن آمون 9، جين العاشر بيئة التفاعل 13، تغيير نفاذية الأمعاء، والقناة الهضمية تكوين الجراثيم 16. وعلاوة على ذلك، يتم تطوير استراتيجيات علاجية وقائية أيضا من هذا 13،16،17 نظام نموذجي. عن طريق حفز MIA في E12.5، وقد أظهرت آخرون أن MIA تنتج تنشيط الجنين دبقية والتغيير التنموي الكوليني في الدماغ الأمامي القاعدية 18، سلالة معينة التفاعل 19، الدماغ الشلل synaptosomal تشوهات التركيبية، والشلل الميتوكوندريا التنفسي abnormalties سلسلة فرط الوظيفة، downregulation من جزيئات synaptosomal الدماغية 17 ،السلوكيات الاكتئاب مثل، وضعف في الإدراك وقرن آمون التقوية على المدى الطويل (الكمونية)، والعجز من البالغين الخلايا العصبية الحصين 20. هنا، ونحن نقدم طريقة مفصلة لكيفية إحداث MIA في E12.5 التي كتبها بولي (I: C)، وكذلك نماذج لكيفية تطبيق هذا النموذج لدراسة مسببات مرض التوحد وانفصام الشخصية. ومن المهم الإشارة إلى أن وزارة الداخلية هو أحد عوامل الخطر لمجموعة متنوعة من الاضطرابات 4، ونتائجها حساسة للغاية للوقت وطريقة الاستقراء وكذلك تربية السدود الحوامل. على هذا النحو، حتى التناقضات الثانوية بين المختبرات في كثير من الأحيان يؤدي إلى استنساخ منخفض و / أو الظواهر المختلفة في النسل. تم تصميم طريقة لدينا خصيصا للراغبين في دراسة MIA كعامل خطورة البيئي لمرض التوحد وانفصام الشخصية، وصفا مفصلا تقديمها سوف يساعد الباحثين على تحسين استنساخ البيانات الخاصة بهم.

<table border="0" cellpadding="0" cellspacing="0" width="711">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:283px;">Polyinosinic&#8211;polycytidylic acid potassium salt</td>
			<td style="width:129px;">SIGMA</td>
			<td style="width:167px;">P9582</td>
			<td style="width:133px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.9% sodium chloride INJ. USP</td>
			<td>HOSPIRA</td>
			<td>NDC 0409-4888-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MONOJECT insuline syrinage 3/10 mL 29G x 1/2&#34;</td>
			<td>COVIDIEN</td>
			<td>8881600145</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical screw cap tubes</td>
			<td>USA SCIENTIFIC</td>
			<td>1500-1211</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop 1000 spectrophotometer</td>
			<td>THERMO SCIENTIFIC</td>
			<td>1000</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stereomicroscope</td>
			<td>Wild Heerbrugg</td>
			<td>M5A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dumont #5 Forceps Inox Tip Size .10 X .06mm</td>
			<td>Roboz</td>
			<td>RS-5045</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAlater RNA stabilization reagent</td>
			<td>Qiagen</td>
			<td>76104</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TRIzol reagent</td>
			<td>Life Technologies</td>
			<td>15596-026&#160;</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RQ1 Rnase-free DNase</td>
			<td>Promega</td>
			<td>M610A</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8891</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastStart universal SYBR green master mix with ROX&#160;</td>
			<td>Roche</td>
			<td>4913922001</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real-time PCR</td>
			<td>ABI</td>
			<td>7300</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 forward</td>
			<td>Life Technologies</td>
			<td>TAGTCCTTCCTACCCCAATTTCC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: Il6 Reverse</td>
			<td>Life Technologies</td>
			<td>TTGGTCCTTAGCCACTCCTTC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin forward</td>
			<td>Life Technologies</td>
			<td>AGAGGGAAATCGTGCGTGAC</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Primer: beta-actin Reverse</td>
			<td>Life Technologies</td>
			<td>CAATAGTGATGACCTGGCCGT</td>
			<td>Optional</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical 96-well reaction plate</td>
			<td>Life Technologies</td>
			<td>4306737</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MicroAmp optical adhesive film&#160;</td>
			<td>Life Technologies</td>
			<td>4311971</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EthoVision</td>
			<td>Noldus</td>
			<td>EthoVision</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SR-LAB apparatus (PPI)</td>
			<td>San Diego Instruments&#160;</td>
			<td>SR-LAB</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Marbles</td>
			<td>PENN-PLAX</td>
			<td>Blue gem stones marbles</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dulbecco&#39;s Phosphate-Buffered Saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>21600-069</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>MACRON</td>
			<td>2621-59</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vibratome</td>
			<td>Leica</td>
			<td>VT1000 S</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium azide</td>
			<td>Sigma</td>
			<td>S2002</td>
			<td>Optionl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton x-100</td>
			<td>Sigma</td>
			<td>X100</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hydrogen peroxide solution</td>
			<td>Sigma</td>
			<td>18312</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat serum</td>
			<td>Vector Laboratories</td>
			<td>S-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rabbit anti-calbindin antibody</td>
			<td>Abcam</td>
			<td>ab11426</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotinlyated goat anti-rabbit IgGantibody</td>
			<td>Vector Laboratories</td>
			<td>BA-1000</td>
			<td>Optionl</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">VECTASTAIN ABC Kit</td>
			<td>Vector Laboratories</td>
			<td>PK-4000</td>
			<td>Optionl</td>
		</tr>
	</tbody>
</table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> حقن 20 ملغ / كغ بولي (I: C) في E12.5 يمكن أن تثير استجابة التهابية حادة في محور الأم والمشيمة والجنين ويعجل له تأثير المزمن لنمو الدماغ والظواهر السلوكية 12،13. مستويات مرتفعة من proinflammatory سايتوكاين، انترلوكين (IL) -6، هو مؤشر موثوق من الاستجابة الالته?...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

تحريض الأم المناعي التنشيط في الفئران في مرحلة منتصف الحمل مع الفيروسية تقليد بولي (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

تحريض التهاب النخامية الذاتية التجريبية في الفئران SJL

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Seven Steps to Stellate Cells

سبع خطوات لخلايا النجمية

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

قياس الحمولة الجرثومية والاستجابات المناعية في الفئران المصابة المستوحدة الليستيريا</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Right Ventricular Systolic Pressure Measurements in Combination with Harvest of Lung and Immune Tissue Samples in Mice

قياسات الضغط البطيني الحق الانقباضي في تركيبة مع حصاد الرئة وعينات الأنسجة المناعية في الفئران

The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is ...

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

تشريح الفطري اشارة المناعة في التهرب الفيروسية من الإنتاج خلوى

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

تحريض الفئران المعوية التهاب عن طريق نقل بالتبني من المستجيب CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; عالية</sup&gt; خلايا T في الفئران العوز المناعي

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

عزل الكريات البيض من أنسجة الفئران في واجهة الأم والجنين

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

تحريض التجريبية المناعة الذاتية التهاب الدماغ في الفئران وتقييم توزيع الأمراض التي تعتمد على خلايا المناعة في الأنسجة المختلفة

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

الثقافات المشيمة وساقطي الجهاز الإنسان لدراسة العدوى في واجهة الأم والجنين

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

تحديد قمع نظام المناعة مقابل حماية الجهاز العصبي المركزي للالدوائية التدخلات في إزالة الميالين المناعة الذاتية

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...