Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

Die geschickte technische Unterstützung von Jasmin Kresse wird dankbar anerkannt.

1. Differenzierung humaner ESC in Richtung Definitive Endoderm <ol><li> Kultivieren humaner embryonaler Stammzellen ( ES- Zellen) in einem Inkubator bei 37 ° C und 5% CO 2. </li><li> Mantel ein neues 6-Well-Zellkulturplatte mit 1 ml einer Basalmembranmatrix und brüten die Kultur-ware für mindestens 30 min bei RT. Für spezielle Informationen wenden Sie sich an die Anweisungen des jeweiligen Herstellers. </li><li> Bestätigen Sie, dass die kultivierten menschlichen WSR 80% -90% Konfluenz unter dem Mikrosk...

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

Derzeit verwendete Differenzierungsprotokolle ergeben sich selten 100% differenzierte Zellen. Aus Gründen, die noch einige Zellen angesprochen werden müssen widerstehen, den Differenzierungsprozess. Abhängig von der Effizienz der verwendeten Differenzierungsprotokoll und die Neigung des ESC Zeile eine bestimmte Anzahl von Rest pluripotenten Zellen häufig beobachtet werden, selbst nach der Differenzierung in die definitive Entoderm. Diese Restzellen können nachgeschaltete Differenzierungen beeinträchtigen oder weit...

Pluripotente Stammzellen wie embryonale Stammzellen (ES-Zellen) haben die Fähigkeit, in nahezu jedem Zelltyp des menschlichen Körpers zu unterscheiden. Somit können in vitro Differenzierungsprotokollen verwendet werden , um zahlreiche adulten Zelltypen wie Kardiomyozyten 1, Hepatozyten 2, beta - Zellen 3, 4 oder Lungenepithelzellen neuronalen Zellen 5 erzeugen. Dies macht WSR ein wertvolles Werkzeug für die mögliche Behandlung von verschiedenen degenerativen Erkrankungen 3. Die in vitro Differenzierung von ES- Zellen gegenüber adulten Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert eine pseudo-Gastrulation in Zellen erinnert an die definitive Endoderm (DE) 6. Da stromabwärts Differenzierung gegenüber den zuvor erwähnten Arten somatischer Zellen wesentlich weniger effizient ist, wird eine optimale Differenzierung Endoderm gilt als geschwindigkeitsbestimmender 7. Die Zellen, die in Richtung der endoderm Linie begangen werden laufen characteristic Veränderungen in ihrem Genexpressionsprofil. Pluripotenz Master - Regulator - Gene herunterreguliert, während die Expression von anderen Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA - Familie und der Oberflächenrezeptor CXCR4 hoch 6 hochreguliert wird, 8, 9. CXCR4 bekannt durch SMAD2 zu trans / 3, hinter Nodal / TGF-β - Signalisierung und SOX17 aufgrund der spezifischen Bindungsstellen in seiner Promotorregion 10. Somit ist es ein sehr geeignet in einer Reihe von Berichten verwendet Marker 6, 8, 11-13. Diese Expressions Änderungen spiegelt eine Pseudo-gastrulation Ereignis, bei dem WSR erste Merkmale eines primitiven streifenartige Zellpopulation zu erwerben und anschließend begehen in die endoderm Keimschicht 6. Allerdings sind Differenzierungsprotokolle selten 100% effizient wie wenige Zellen den Differenzierungsprozess widerstehen kann oder Differenzierung gegenüber anderen unbeabsichtigten Linien 14. Diese Zellen können sich negativ auf Influence weitere Differenzierung. Darüber hinaus bergen Rest undifferenzierten Zellen große Risiken für spätere Experimente Transplantation und kann zu teratomas 15-17 geben. So entfernen Sie können diese unerwünschten Zellen früh auf den Oberflächenmarker CXCR4 zur Reinigung von Zellen verwendet werden , die in Richtung der DE 18 verpflichtet sind. Hier beschreiben wir ein Verfahren für die positive Selektion von CXCR4 + -Zellen aus DE Differenzierungskulturen. Hierzu wird die Oberflächenmarker CXCR4 durch einen Antikörper gebunden, der dann wiederum mit magnetischen Microbeads bindet. Im Gegensatz zu den harten Bedingungen während FACS-Sortierung, die magnetisch markierten DE-ähnlichen Zellen können dann leicht in einem Benchtop-Format gereinigt werden, um eine sanfte Reinigungsverfahren verwendet wird. Dieses Protokoll stellt eine einfache Methode zur Entfernung von Zellpopulationen, die die DE Differenzierungsprozess widerstanden.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

Die Differenzierung Fähigkeiten von pluripotenten Stammzellen wie embryonale Stammzellen (ES-Zellen) ermöglichen eine mögliche therapeutische Anwendung für Zell-Ersatz-Therapien. Ausdifferenzierten Zelltypen könnten für die Behandlung von verschiedenen degenerativen Krankheiten verwendet werden. In vitro Differenzierung dieser Zellen gegenüber Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert als ersten Schritt die Erzeugung von endgültigen endodermalen Zellen. Dieser Schritt ist geschwindigkeitsbestimmend für die weitere Differenzierung zu endständig gereiften Zelltypen, wie beispielsweise Insulin-produzierenden Beta-Zellen, Hepatozyten oder anderen Endoderm-abgeleiteten Zelltypen. Die Zellen, die in Richtung der endoderm Linie verpflichtet sind ausdrücken sehr eine Vielzahl von Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA-Familie, und der Oberflächenrezeptor CXCR4. Allerdings Differenzierungsprotokolle sind selten 100% effizient. Hier beschreiben wir ein Verfahren zur Reinigung eines CXCR4 + Zellpopulation nach der Differenzierungin der DE durch magnetische Mikrokugeln verwendet. Diese Reinigung entfernt zusätzlich Zellen von unerwünschten Linien. Die sanfte Reinigungsverfahren ist schnell und zuverlässig und kann verwendet werden, Downstream-Anwendungen und Differenzierungen zu verbessern.

Bei der Differenzierung WSR laufen drastischen Veränderungen in der Gen und Proteinexpression. Figur 1 typische Markergene darstellt , die verwendet werden können , eine erfolgreiche Endoderm Differenzierung zu verifizieren. Prime Ziele für eine Genexpressionsanalyse sind GSC, FOXA2 und SOX17. In einer relativen Analyse der Genexpression insbesondere FOXA2 und SOX17 erhöht von&gt; 2.000 - fache , wenn si...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden.

Eine schnelle und effiziente Methode zur Reinigung von Entodermzellen generiert aus humanen embryonalen Stammzellen

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

Effiziente Ableitung von Retinapigmentepithel-Zellen aus Stammzellen

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Forschung

Entwicklungsbiologie

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horizontale Ganze Mount: Ein neuartiges Verarbeitungs- und Imaging-Protokoll für dickes, dreidimensionales Gewebequerschnitt der Haut

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

Schnelle, gezielte Differenzierung der retinalen Pigment epithelialen Zellen aus menschlichen embryonalen oder induzierte pluripotente Stammzellen

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Einzellige Ladungszustand im lebendigen intakten Zebrafisch

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computergestützte Analyse der Keimbahn Caenorhabditis Elegans , die Verteilung der Kerne, Proteine und das Zytoskelett zu studieren

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

Effiziente und skalierbare gerichtete Differenzierung von klinisch kompatibel Hornhaut limbischen epithelialen Stammzellen aus menschlichen pluripotenten Stammzellen

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

Effiziente Differenzierung menschlicher pluripotenter Stammzellen in Leberzellen

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In vitro-Generation der Somiten Derivate aus menschlichen induzierten Zellen pluripotenten Stammzellen

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

Eine statische selbstgesteuerte Methode zur Generierung von Hirnorganoiden aus menschlichen embryonalen Stammzellen

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

Effiziente neuronale Differenzierung mit einzelzellischer Kultur menschlicher embryonaler Stammzellen

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular ...