Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

הסיוע הטכני המיומן של יסמין Kresse היא הודתה בהכרת תודה.

בידול 1. של האדם ESC כלפי האנדודרם המכריע <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> טפחו את תאי גזע עובריים אנושיים (ESCs) באינקובטור ב 37 מעלות צלזיוס, 5% CO 2. </li><li style=";text-align:right;direction:rtl"> מעיל צלחת תרבות 6 היטב סלולרי חדש עם 1 מ&quot;ל של מטריצה ​​קרום במרתף דגירה כ?...

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

נכון לעכשיו פרוטוקולי בידול לעתים נדירות לגרום תאים מובחנים 100%. מסיבות שעדיין יש לטפל תאים מסוימים להתנגד לתהליך הבידול. בהתאם את היעילות של פרוטוקול בידול המשמשים ואת הנטייה של ESC קו מספר מסוים של תאים פלוריפוטנטיים שיורית הם נצפו גם בכינויו לאחר בידול לתוך האנדודר...

תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) יש את היכולת להתמיין כמעט כל סוג תא בגוף האדם. לפיכך, פרוטוקולים בידול במבחנה יכול לשמש כדי ליצור סוגי תאים בוגרים רבים כגון cardiomyocytes 1, hepatocytes 2, תאי בטא 3, ריאות אפיתל 4 או 5 תאים עצביים. זה עושה ESCs כלי רב ערך לטיפול הפוטנציאל של מחלות ניווניות שונות 3. בידול במבחנה של ESCs כלפי רקמות בוגרות של ריאות, כבד ולבלב דורש פסאודו gastrulation לתאים מזכיר את האנדודרם סופי (DE) 6. מאז בידול במורד כלפי סוגי תאים סומטיים הנ&quot;ל הוא משמעותי פחות יעיל, בידול האנדודרם אופטימלי נחשב הגבלת קצב 7. תאים מחויבים כלפי שושלת endoderm לעבור צ&#39;השינויי racteristic בפרופיל ביטוי הגנים שלהם. מאסטר pluripotency גנים הרגולטור למטה מוסדרים, ואילו הביטוי של גורמי שעתוק אחרים כגון FOXA2, SOX17, HNF1B, בני משפחת Gata ואת לקולטן CXCR4 הוא שהוגברו מאוד 6, 8, 9. CXCR4 ידוע להיות transactivated ידי SMAD2 / 3, במורד זרם של איתות קטרים ​​/ TGF-β ו SOX17 בשל אתרי קישור ספציפיים באזור האמרגן שלה 10. לכן הוא סמן מתאים מאוד בשימוש מספר הדיווחים 6, 8, 11-13. שינויי ביטוי אלה משקפים אירוע פסאודו gastrulation, שבו ESCs לרכוש הראשונה מאפיינים של אוכלוסיית תא פס דמוי פרימיטיבית ובהמשך להתחייב לתוך השכבה ניבטת endoderm 6. עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים כמו כמה תאים עשויים להתנגד לתהליך הבידול או להבדיל כלפי שושלות מכוונות אחרות 14. תאים אלה עשויים לרעה influeבידול נוסף NCE. יתר על כן, תאים שלא עברו התמיינות שיורית נמל סיכונים גדולים לניסויי השתלה מאוחר יותר עשוי להצמיח teratomas 15-17. כדי להסיר תאים לא רצויים אלה מוקדם על CXCR4 סמן המשטח יכול לשמש עבור טיהור של תאים מחויבים כלפי DE 18. כאן אנו מתארים שיטת הסלקציה החיובית של CXCR4 + תאים מתרבויות בידול DE. לשם כך, CXCR4 סמן המשטח מחויב נוגדן אשר בתורם נקשר microbeads המגנטי. בניגוד לתנאים הקשים במהלך מיון FACS, תאי DE הדמויים המתויגים מגנטי אז יכולים להיות מטוהרים בקלות בפורמט המעבדתיים באמצעות שיטת טיהור עדינה. פרוטוקול זה מספק שיטה פשוטה להסרת אוכלוסיות תאי המגן מפני תהליך התמיינות DE.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

יכולות ההתמיינות של תאי גזע פלוריפוטנטיים כגון תאי גזע עובריים (ESCs) לאפשר יישום טיפולי פוטנציאל טיפולי התחדשות תאים. סופני סוגי תאים מובחנים יכול לשמש לטיפול במחלות ניווניות שונות. חוץ גופית התמיינות של תאים אלה כלפי רקמות של ריאות, כבד ולבלב דורש כצעד ראשון הדור של תאים endodermal מוחלטות. שלב זה הוא הגבלת קצב לבידול נוסף לקראת סוגי תאים התבגר סופני כגון תאי ביתא מייצרי אינסולין, hepatocytes או סוגי תאים אחרים הנגזרות האנדודרם. תאים מחויבים כלפי השושלת endoderm מאוד להביע שפע של גורמי שעתוק כגון FOXA2, SOX17, HNF1B, בני משפחת גאטה, ואת לקולטן CXCR4. עם זאת, פרוטוקולי בידול הם לעתים רחוקות 100% יעילים. כאן אנו מתארים שיטה לטיהור של אוכלוסיית תא CXCR4 + לאחר התמיינותאל DE באמצעות microbeads מגנטי. טיהור זה גם מסיר תאים של שושלות רצויות. שיטת הטיהור העדינה היא מהירה ואמינה ועשויה לשמש כדי לשפר יישומי differentiations במורד זרם.

עם בידול ESCs לעבור שינויים דרסטיים גנים ביטוי חלבון. איור 1 מתאר גנים סמן טיפוסי שניתן להשתמש בהם כדי לאמת בידול האנדודרם מוצלח. מטרות הממשלה עבור ניתוח ביטוי גנים הם GSC, FOXA2, ו SOX17. בניתוח ביטוי גנים ביחס במיוחד FOXA2</em...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

כאן אנו מתארים שיטה לטיהור של תאי גזע עובריים אנושיים הבדילו כי מחויב כלפי האנדודרם הסופי לשיפור יישומים במורד בידול נוסף.

שיטה מהירה ויעילה עבור טיהור של תאים האנדודרם המופקים מתאי גזע עובריים אנושיים

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

גזירה יעילה של תאי הרשתית פיגמנט האפיתל מתאי גזע

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

אופקי הר שלם: עיבוד רומן פרוטוקול הדמיה על רקמה עבה, תלת מימדי חתכים של העור

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

הבידול מהירה, מכוונת של תאים אפיתל הפיגמנט ברשתית מתאי גזע Pluripotent האנושי עובריים או מושרה

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Photoconversion תא בודד בהמחיה שלם דג זברה

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

ניתוח חישובית של Germline Caenorhabditis elegans ללמוד הפצה של גרעינים, חלבונים ו את שלד התא

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

יעיל ומדרגי הבידול בבימויו של קלינית הקרנית Limbal אפיתל תאי גזע מתאימים מתאי גזע Pluripotent אנושי

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

יעיל הבידול של תאים האדם Pluriפוטנטי לתוך תאי הכבד

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

בדור חוץ גופית של Somite נגזרים מן האדם המושרה בתאי גזע Pluripotent

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

שיטת בימוי עצמי סטטי ליצירת אורגנואידים המוח מתאי גזע האדם העובריים

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

בידול עצבי יעיל באמצעות התרבות תא יחיד של תאי גזע האדם העובריים

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular ...