Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

재스민 Kresse의 숙련 된 기술 지원은 기꺼이 인정 받고 있습니다.

확실한 내배엽으로 인간의 ESC 1. 차별화 <ol><li> 37 ℃ 배양기에서 인간 배아 줄기 세포 (는 ESC)를 배양하고, 5 % CO 2. </li><li> 코트 기저막 매트릭스 1 ㎖와 새로운 6- 웰 세포 배양 접시에 RT에서 적어도 30 분 동안 배양 도자기 부화. 특정 자세한 내용은 각 제조업체의 지침을 켜십시오. </li><li> 배양 된 인간는 ESC (예 : 4X) 낮은 배율을 사용하여 현미경으로 80 % -90 %의 포화 상태에 도달했?...

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

현재 사용 분화 프로토콜은 거의 100 % 차별화 된 세포에서 발생합니다. 아직 해결해야 할 몇 가지 이유로 세포 분화 과정 레지스트. 사용 된 분화 프로토콜의 효율 및 ESC의 성향에 따라 잔류 다 능성 세포의 소정 수는 일반적으로, 심지어 최종 내배엽으로 분화 후에 관찰되는 광고. 이러한 잔류 세포는 transcriptomics, 단백질 체학 및 miRNA의 발현 분석 등 다운 스트림 분화 또는 추가 분석을 방해 할 수 ...

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포는 신체의 거의 모든 세포 유형으로 분화 할 수있는 능력을 가지고있다. 따라서, 생체 외 분화 프로토콜은 심근 1 간세포 2, 3 베타 세포, 폐 상피 4 또는 5 신경 세포 등 다양한 성인 세포 유형을 생성하기 위해 사용될 수있다. 이는 ESC에게 다양한 퇴행성 질환 (3)의 잠재적 인 치료를위한 유용한 도구를 만든다. 폐, 간, 췌장의 성인 조직으로는 ESC의 체외 분화는 최종 내배엽 (DE) 6 연상 세포로 의사 낭 배기가 필요합니다. 상기 체세포 유형 하류쪽으로 분화 상당히 비효율적이기 때문에, 최적의 내배엽 분화는 7 레이트 제한으로 간주된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 차를 받다이들 유전자 발현 프로파일 racteristic 변한다. 능성 마스터 조절 유전자 다운 규제 예 9. CXCR4가 된 Smad2 의해 transactivated 것으로 알려져 FOXA2, SOX17, HNF1B, GATA 가족 구성원과 CXCR4 높은 6 상향 조절되어 표면 수용체 (8)과 같은 다른 전사 인자의 발현 반면 / 3, 인해 프로모터 영역 (10)의 특정 결합 부위에 결절 / TGF-β 신호 및 SOX17의 하류. 따라서 리포트 6, 8, 11 ~ 13의 번호를 사용 매우 적합한 마커이다. 이러한 발현 변화는 ESC는 먼저 기본 연속 형 세포 집단의 특성을 획득하고이어서 배아 내배엽 층 (6)에 투입하는 의사 낭배 이벤트를 반영한다. 몇 세포가 분화 과정에 저항 또는 다른 의도하지 않은 계통 (14)으로 구별 할 수있다 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 이러한 세포 부정적인 influe있다후부 더 차별화. 또한, 잔여 미분화 세포는 나중에 이식 실험에 대한 큰 위험을 항구 및 기형 종 15-17을 야기 할 수 있습니다. 초기에 표면 마커 CXCR4 드 (18)를 향해 최선을 다하고 있습니다 세포의 정제에 사용할 수있는 이러한 원치 않는 세포를 제거합니다. 여기서는 DE 분화 배양에서 CXCR4 + 세포의 양성 선별을위한 방법을 설명한다. 이를 위해 표면 마커 CXCR4 후 다시 자성 마이크로 비드에 결합 된 항체에 의해 결합된다. FACS 정렬 동안 가혹한 조건 달리 자기 표지 DE 같은 세포를 쉽게 부드러운 정제 방법을 사용하여 벤치 탑 형태로 정제 될 수있다. 이 프로토콜은 DE 분화 과정 저항 세포 집단을 제거하기위한 간단한 방법을 제공한다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포의 분화 능력은 세포 대체 요법에 대한 잠재적 인 치료 적 적용을 허용한다. 말단 분화 세포 유형. 각종 퇴행성 질환의 치료에 사용되는 폐, 간 및 췌장 조직을 향해 이러한 세포의 체외 분화는 첫 단계로 최종 내배엽 세포의 생성을 필요로 할 수있다. 이 단계는 속도 제한 인슐린 - 생산 베타 세포, 간세포 등 내배엽 유래의 세포 유형으로 말단 성숙 세포 유형 향해 더 분화된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 매우 같은 FOXA2, SOX17, HNF1B, GATA 가족의 구성원, 표면 수용체 CXCR4 같은 전사 인자의 군중을 표현한다. 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 여기서는 분화 후 CXCR4 + 세포군의 정제 방법을 서술자기 마이크로 비드를 사용하여 DE에. 이 정제는 또한 원치 않는 계통의 세포를 제거합니다. 부드러운 정제 방법은 신속하고 신뢰성 및 하류 어플리케이션 및 분화를 개선하는 데 사용될 수있다.

분화시 는 ESC 유전자와 단백질 발현의 급격한 변화를 겪는다. 1 성공적인 내배엽 분화를 확인하는 데 사용할 수있는 일반적인 마커 유전자를 보여주고있다. 유전자 발현 분석을위한 주요 목표 GSC, FOXA2 및 SOX17있다. 미분화는 ESC에 비해 상대적 유전자 발현 분석에서 특히 FOXA2 및 SOX17는&gt; 000 배 증가?...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

여기서는 하류 어플리케이션 및 상기 분화의 개선을위한 결정적인 내배엽으로 분화 노력하고 인간 배아 줄기 세포의 정제를위한 방법을 설명한다.

인간 배아 줄기 세포로부터 생성 된 내배엽 세포의 정제를위한 신속하고 효율적인 방법

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

줄기 세포에서 망막 색소 상피 세포의 효율적인 유도

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

연구

발생학

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

수평 한 전체적인 거치 : 피부의 두껍고, 3 차원 조직 단면도를위한 비발 한 가공 그리고 화상 진찰 의정서

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

인간의 배아 또는 유도 만능 줄기 세포에서 망막 안료 상피 세포의 급속 한, 감독 차별화

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

생활 그대로 Zebrafish에 단일 셀 Photoconversion

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

꼬마 선 충 생식 핵의 분포, 단백질, 및 골격을 전산 분석

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

임상 호환 막 Limbal 상피 줄기 세포 인간 만능 줄기 세포에서의 효율적이 고 확장 가능한 감독된 차별화

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

인간 다능성 줄기 세포를 간 세포로 효율적으로 분화

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

인간 유도에서 Somite 파생 상품의 체 외 발생에서 만능 줄기 세포

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

인간 배아 줄기 세포에서 뇌 오르가노이드를 생성하기위한 정적 자기 지향 방법

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

인간 배아 줄기 세포의 단세포 배양을 이용한 효율적인 신경 분화

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular ...