Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

Den dyktige teknisk assistanse av Jasmin Kresse er takknemlig erkjent.

1. Differensiering av menneskelig ESC mot Definitive endoderm <ol><li> Dyrke humane embryonale stamceller (ESCs) i en inkubator ved 37 ° C og 5% CO 2. </li><li> Belegge en ny 6-brønners cellekulturplate med 1 ml av en basalmembran matrise og inkubere kulturen-ware i minst 30 minutter ved romtemperatur. For spesifikke detaljer vennligst slå til den respektive produsentens instruksjoner. </li><li> Kontroller at dyrkede humane ESCs har nådd 80% -90% konfluens under mikroskopet ved hjelp av en lav forstørr...

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

For tiden anvendes differensieringsprotokoller sjelden resultere i 100% differensierte celler. Av grunner som fortsatt må tas opp noen celler motstå differensieringsprosessen. Avhengig av effektiviteten av den brukte protokoll differensiering og tilbøyelighet til ESC linje et visst antall av gjenværende pluripotente celler blir ofte observert selv etter differensiering til den definitive endoderm. Disse gjenværende cellene kan svekke nedstrøms differentiations eller videre analyse som transcriptomics, proteomikk o...

Pluripotente stamceller slik som embryonale stamceller (ESCS) har evnen til å differensiere i praktisk talt en hvilken som helst celletype av menneskekroppen. Således kan in vitro differensiering protokoller brukes til å generere en rekke voksen celletyper som for eksempel kardiomyocytter 1, hepatocytter 2, beta-cellene 3, lunge epitelial 4 eller 5 nevronale celler. Dette gjør ESCs et verdifullt verktøy for potensiell behandling av ulike degenerative sykdommer 3. Den in vitro differensiering av ESCs mot voksent vev i lunge, lever og bukspyttkjertel krever en pseudo-gastrulation inn i celler som minner om den definitive endoderm (DE) 6. Siden nedstrøms differensiering mot de nevnte somatiske celletyper er betydelig mindre effektiv, er en optimal endoderm differensiering regnes som hastighetsbegrensende 7. Celler som er begått mot endoderm avstamning gjennomgå chagent endringer i genekspresjon profilen. Pluripotency stam regulatoriske gener er nedregulert, mens ekspresjonen av andre transkripsjonsfaktorer slik som FOXA2, SOX17, HNF1B, medlemmer av Gata familien og den overflatereseptoren CXCR4 er sterkt oppregulert 6, 8, 9. CXCR4 er kjent for å være transactivated ved SMAD2 / 3, nedstrøms Nodal / TGF-β signalering og SOX17 skyldes spesifikke bindingssteder i sin promoter region 10. Således er det et svært egnet markør som brukes i en rekke rapporter 6, 8, 11-13. Disse uttrykk endringene reflekterer en pseudo-gastrulation hendelse, der ESCs først få egenskapene til en primitiv strek-lignende cellepopulasjon og deretter begå inn i endoderm bakterie lag 6. Men differensiering protokoller er sjelden 100% effektiv som noen celler kan motstå differensiering prosess eller skille mot andre utilsiktede linjene 14. Disse cellene kan ha negativ influensaNCE ytterligere differensiering. Videre gjenværende udifferensierte celler båtplass stor risiko for senere transplantasjon eksperimenter og kan gi opphav til teratomas 15-17. For å fjerne disse uønskede celler tidlig på overflaten markør CXCR4 kan brukes for rensingen av celler som er begått mot DE 18. Her beskriver vi en fremgangsmåte for positiv utvelgelse av CXCR4 + -celler fra DE differensierings kulturer. For dette er den overflatemarkør CXCR4 bindes av et antistoff, som deretter i sin tur binder seg til magnetiske mikrokuler. I motsetning til de tøffe forholdene under FACS sortering, de magnetisk merket DE-lignende celler kan da lett bli renset i en benkeplate Bøk format med en mild rensemetode. Denne protokollen tilveiebringer en grei metode for fjerning av cellepopulasjoner som motsto DE differensieringsprosessen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

Differensieringen egenskapene til pluripotente stamceller som embryonale stamceller (ESCs) tillate en potensiell terapeutisk anvendelse for celle erstatning terapi. Terminalt differensierte celletyper kan brukes for behandling av forskjellige degenerative sykdommer. In vitro differensiering av disse cellene overfor vev i lunger, lever og bukspyttkjertel krever som et første trinn dannelsen av definitive endodermal celler. Dette trinnet er hastighetsbegrensende for ytterligere differensiering mot døds modnet celletyper som insulinproduserende betaceller, leverceller eller andre endoderm-avledet celletyper. Celler som er begått mot endoderm avstamning sterkt uttrykke et mangfold av transkripsjonsfaktorer som FOXA2, SOX17, HNF1B, medlemmer av GATA familien, og overflaten reseptor CXCR4. Men differensiering protokoller er sjelden 100% effektiv. Her beskriver vi en fremgangsmåte for rensing av en CXCR4 + cellepopulasjon etter differensieringinn i DE ved hjelp av magnetiske mikroperler. Dette rensing fjerner tillegg celler av uønskede linjer. Den milde rensemetode er rask og pålitelig og kan brukes til å forbedre nedstrøms applikasjoner og differensieringer.

Ved differensiering ESCs gjennomgå drastiske endringer i genet og proteinekspresjon. Figur 1 viser typiske markørgener som kan brukes for å bekrefte en vellykket endoderm differensiering. Førsteklasses mål for en genekspresjonsanalyse er GSC, FOXA2, og SOX17. I en relativ genekspresjonsanalyser spesielt FOXA2 og SOX17 er økt med&gt; 2000 ganger i forhold til udifferensierte ESCs. GSC allerede ...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Her beskriver vi metode til rent differensierte humane stamceller som begått mot definitive endoderm for forbedring nedstrøms søknader og ytterligere differentiations.

En rask og effektiv metode for rensing av endoderm celler generert fra humane embryonale stamceller

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

Effektiv Utledning av retinal pigment epitelet Celler fra stamceller

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horisontal helmontering: En romanbehandlings- og bildeprotokoll for tykke, tredimensjonale vev Tverrsnitt av huden

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

Rask, rettet differensiering av netthinnens Pigment epitelceller fra menneskelige embryonale eller indusert Pluripotent stamceller

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Encellede Photoconversion i levende intakt sebrafisk

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Beregningsorientert analyse av Caenorhabditis elegans Germline å studere distribusjon av kjerner, proteiner og Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

Effektiv og skalerbar rettet differensiering av klinisk kompatibel hornhinnen Limbal epitel stamceller fra menneskelige Pluripotent stamceller

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

Effektiv differensiering av Human Pluripotent stamceller i leverceller

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

I Vitro generasjon av Somite derivater fra menneske indusert stamceller Pluripotent

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

En statisk selvrettet metode for å generere hjerneorganoider fra humane embryonale stamceller

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

Efficient Neural Differentiation using Single-Cell Culture of Human Embryonic Stem Cells

Effektiv neural differensiering bruker single-Cell kultur av Human embryonale stamceller

In vitro differentiation of human embryonic stem cells (hESCs) has transformed the ability to study human development on both biological and molecular ...