Name: high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots
Uploaded: 2016-04-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

Denne forskning blev støttet af National Science Foundation tilskud IOS-1025642 (GBM). Vi takker Maria Harrison til tilvejebringelse af ARqua1 stamme.

1. Guide RNA Design og Vector Construction <ol><li> Identificere målsekvenser for generne af interesse. Der er en række online CRISPR target-finding programmer er egnede til dette trin 13,14. BEMÆRK: Her bruger vi GN 20 GG mål motiv, men andre udformninger kan være egnede afhængig af anvendelsen eller vektor, der anvendes. </li><li> Design 60-mer gRNA oligoer at medtage GN 19 del af target-motiver flankeret af 5 &#39;og 3&#39; 20 nt sekvenser, som kræves til DNA samling. ...

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

Evnen til at generere målrettede DNA ændringer med CRISPR / Cas9 har et stort potentiale inden for funktionel genomforskning studier. Der er to komponenter af CRISPR / Cas9 systemet; den Cas9 nuklease, afledt af Staphylococcus pyogenes og en ca. 100-nt guide RNA (gRNA) molekyle, der dirigerer Cas9 til det målrettede DNA site (s) 1. Target anerkendelse bibringes af den første ~ 20 nt af gRNA, som giver mulighed for high-throughput produktion af targeting vektorer 2,3. De fleste organismer, der kan manipuleret, allerede har været med CRISPR / Cas9 teknologi 4,5. I planter, konstitutive promotorer, såsom CaMV 35S-promotoren, anvendes almindeligvis til at drive ekspressionen af Cas9 nuclease 6. De gRNAs udtrykkes ved anvendelse af de RNA-polymerase III U6 eller U3 promotorer, der begrænser den første base af gRNA til enten et G, for U6, eller A for U3, til effektiv transkription. Imidlertid RNA-polymerase II promoters, der er fri for disse begrænsninger, er også blevet anvendt 7,8. Forskellige gRNAs inducerer DNA-mutationer med forskellige virkningsgrader, og så det kan være vigtigt først at validere CRISPR vektorer før man investerer i hel-plante transformationer eller oprette omfattende fænotypiske skærme. Transient ekspression af CRISPR-konstruktioner i planter ved anvendelse agroinfiltration for eksempel generelt resulterer i en lavere frekvens af DNA modifikation sammenlignet med stabile planter 6, hvilket gør påvisning af mutationer vanskelige og fænotypiske assays upraktisk med sådanne fremgangsmåder. Såkaldte hårede rødder er en bekvem, alternativt system siden kan genereres et stort antal uafhængige, stabilt transformerede materialer inden for uger, i modsætning til måneder for stabile planter. CRISPR vektorer er meget effektive til at inducere DNA-mutationer i hårrødder 9,10. DNA samlingsmetoder effektivt ligere DNA-fragmenter indeholdende overlapping ender 11. En væsentlig fordel ved nogle DNA samlingsmetoder er evnen til at inkorporere ssDNA (dvs. oligoer) i den samlede produkter. Da gRNAs kun ~ 20 nt lang og kan gøres nye mål med syntetiserede oligoer, disse DNA samlingsmetoder er velegnede til CRISPR kloning. De her beskrevne protokoller er baseret på P201 serie CRISPR vektorer, som er blevet anvendt i sojabønne 10, poppel 12 og nu tomat. Kloningen præsenteret tilbyder flere fordele i forhold til den aktuelle kloning metode 10. Nemlig, kan fuldt funktionelle vektorer blive frembragt i en enkelt kloning reaktion på en enkelt dag. Vector konstruktion kan også samles til at generere flere CRISPR vektorer i parallel, hvilket yderligere reducerer hands-on tid og materialeomkostninger. Vi præsenterer også en protokol til generering af tomater hårrødder som en effektiv metode til at producere transgene materialer med målrettede gendeletioner. Hårrødder bruges til gyldigspiste CRISPR vektorer og tilvejebringe materiale til efterfølgende eksperimenter.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR vektor konstruktion med DNA samling genererer typisk ti til hundrede uafhængige kloner. Colony screening ved PCR nemt identificerer korrekte kloner og kan skelne mellem plasmider med og uden indsatse (Figur 2A), som er nyttige for fejlfinding. Typisk alle klonerne indeholder en indsats og en bruger kan vælge at springe koloni screening skridt helt. Diagnostiske fordøjelser (figur 2B) og Sanger-sekventering anvendes til kvalitetskontrol. Når de...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

High-throughput CRISPR Vector Konstruktion og karakterisering af DNA Ændringer af Generation of Tomato Behårede Roots

Anvendelse af DNA samling, kan flere CRISPR vektorer konstrueres parallelt i en enkelt kloning reaktion, hvilket gør konstruktionen af ​​et stort antal CRISPR vektorer en enkel opgave. Tomat hårrødder er en glimrende modelsystem til at validere CRISPR vektorer og generere mutant materialer.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

Research

JoVE Journal

Biology

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: En metode til Voksende Arabidopsis Og tomatplanter i 96-brønds plader for High-Throughput genotypebestemmes

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

Substrat Generation for endonukleaser af CRISPR / Cas Systems

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

Generering af høj kvalitet Chromatin Immunoprecipitation DNA Skabelon til High-throughput sekventering (Chip-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

Målrettet DNA methyleringsanalyse by Next generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

High-throughput screening for kemiske modulatorer af post-transkriptionelt regulerede gener

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DamID-seq: Genome-wide Kortlægning af protein-DNA interaktioner af High Throughput sekventering af adenin-methylerede DNA fragmenter

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

High Resolution Kvantificering af krystallinsk cellulose Ophobning i<em&gt; Arabidopsis</em&gt; Roots til Monitor Tissue-specifikke Cell Wall Ændringer

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Forstærkning, Næste generations sekventering, og Genomisk DNA Kortlægning af retroviral integration steder

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Isolation, karakterisering og High Throughput ekstracellulære Flux analyse af musen primær Renal tubulær epitelceller

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...