Name: high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots
Uploaded: 2016-04-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

Diese Forschung wurde von der National Science Foundation Grant IOS-1025642 (GBM) unterstützt. Wir danken Maria Harrison für den ARqua1 Stamm bereitstellt.

1. Leitfaden RNA Entwurf und Vektorkonstruktion <ol><li> Identifizieren Sie Zielsequenzen für die Gene von Interesse. Es gibt eine Vielzahl von Online - CRISPR Zielfindungsprogramme geeignet für diesen Schritt 13,14. HINWEIS: Hier verwenden wir den GN 20 GG Zielmotiv, aber andere Konstruktionen geeignet sein können , abhängig von der Anwendung oder Vektorsystem verwendet wird . </li><li> Design 60-mer gRNA Oligos der GN 19 Teil der Zielmotive von 5 &#39;und 3&#39; 20-nt - Se...

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

Die Möglichkeit, gezielte DNA-Modifikationen mit CRISPR zu erzeugen / Cas9 hat ein großes Potenzial für funktionelle Genomik Studien. Es gibt zwei Komponenten des CRISPR / Cas9 Systems; die Cas9 Nuklease, abgeleitet von Staphylococcus pyogenes und einer etwa 100-nt Führungs RNA (gRNA) Molekül , das Cas9 die gezielte DNA - Stelle (n) 1 leitet. Zielerkennung wird durch den ersten übertragenen ~ 20-nt der gRNA, die für Hochdurchsatzproduktion von Targeting - Vektoren 2,3 ermöglicht. Die meisten Organismen , die so konstruiert werden können, bereits mit CRISPR / Cas9 Technologie 4,5 haben. In Pflanzen, konstitutive Promotoren, wie den CaMV 35S - Promotor, werden üblicherweise zum Antrieb der Expression der Nuklease Cas9 6 verwendet. Die gRNAs exprimiert werden, die RNA-Polymerase III U6 oder U3 Promotoren, die die erste Basis des gRNA schränkt entweder ein G, für U6 oder A für U3, für eine effiziente Transkription. Allerdings prom RNA-Polymerase IIOters, die frei von diesen Beschränkungen sind, wurden ebenfalls 7,8 verwendet. Verschiedene gRNAs DNA-Mutationen mit unterschiedlichen Effizienzen, induzieren und so kann es wichtig sein, um erste CRISPR Vektoren validieren, bevor in Ganzpflanzentransformationen zu investieren oder umfangreiche phänotypische Bildschirme einrichten. Transiente Expression von CRISPR - Konstrukte in Pflanzen durch Agroinfiltration beispielsweise unter Verwendung, führt im allgemeinen zu einer niedrigeren Frequenz Modifikations DNA im Vergleich zu stabilen Pflanzen 6, was den Nachweis von Mutationen schwieriger und phänotypischen Assays unpraktisch mit solchen Ansätzen. Sogenannte Haarwurzeln sind eine bequeme, alternative System, da eine große Anzahl von unabhängigen, stabil transformierte Materialien können innerhalb von Wochen erzeugt werden, wie für eine stabile Pflanzen Monate gegenüber. CRISPR Vektoren sind sehr effektiv DNA - Mutationen in Haarwurzeln 9,10 bei der Induktion. DNA-Montageverfahren abzubinden effizient DNA-Fragmente enthalten, überlastapping Enden 11. Ein wesentlicher Vorteil einiger DNA Montageverfahren ist die Fähigkeit , ssDNA (dh Oligos) in die zusammengesetzten Produkte einzuarbeiten. Da gRNAs nur ~ 20-nt lang und neue Ziele sind mit synthetisierten Oligos hergestellt werden, sind diese DNA-Montageverfahren gut zu CRISPR Klonen geeignet. Die Protokolle werden hier beschrieben auf der P201 - Reihe von CRISPR Vektoren basieren , die 10 Sojabohnen-, Pappel 12 erfolgreich eingesetzt wurde und nun Tomate. Das Klonierungsverfahren präsentiert bietet mehrere Vorteile gegenüber dem aktuellen Klonmethode 10. Nämlich voll funktionsfähige Vektoren können in einem einzigen Reaktions Klonierung in einem einzigen Tag erzeugt werden. Vektorkonstruktion kann auch mehrere CRISPR Vektoren parallel weiter zu reduzieren Handhabungszeit und Materialkosten zu erzeugen gepoolt werden. Wir stellen auch ein Protokoll für die Erzeugung von Tomatenhaarwurzeln als eine effiziente Methode transgenen Materialien mit Zielgen Deletionen zu erzeugen. Hairy Wurzeln sind gültig verwendetaßen die CRISPR Vektoren und liefern Material für nachfolgende Experimente.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR Vektorkonstruktion mit DNA-Baugruppe erzeugt typischerweise Dutzende bis Hunderte von unabhängigen Klonen. Colony Screening durch PCR identifiziert leicht korrekte Klone und kann zwischen Plasmide mit und ohne Einlagen (2A) unterscheiden , die für die Fehlersuche nützlich ist. Typischerweise enthalten alle Klone ein Insert und ein Benutzer entscheiden kann, die Kolonie-Screening Schritte ganz zu überspringen. Diagnostische Digests (2B) und San...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

High-throughput CRISPR Vector Konstruktion und Charakterisierung von DNA-Modifikationen durch Erzeugung von Tomaten Hairy Roots

Verwendung von DNA-Baugruppe können mehrere CRISPR Vektoren parallel in einem einzigen Reaktions Klonierung konstruiert werden, wodurch die Konstruktion einer großen Anzahl von CRISPR Vektoren eine einfache Aufgabe. Tomato Haarwurzeln sind ein ausgezeichnetes Modellsystem CRISPR Vektoren zu validieren und mutierten Materialien erzeugen.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

Research

JoVE Journal

Biology

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Generierung von RNA / DNA-Hybride in genomischer DNA durch Transformation mit RNA-haltigen Oligonukleotiden

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Forschung

Biologie

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: Ein Verfahren zur Züchtung von Arabidopsis Und Tomatenpflanzen in 96-well-Platten für High-Throughput-Genotypisierung

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

Generierung von High Quality Chromatin Immunpräzipitation DNA Vorlage für Hochdurchsatz-Sequenzierung (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

Gezielte DNA Methylierungsanalyse von Next-Generation-Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Hochdurchsatz-Screening für Chemische Modulatoren der Post-transkriptionell regulierten Genen

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DAMiD-seq: Genomweite Mapping von Protein-DNA-Wechselwirkungen von Hochdurchsatz-Sequenzierung von Adenin-methylierten DNA-Fragmenten

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Hohe Auflösung Quantifizierung kristalliner Cellulose Akkumulation in<em&gt; Arabidopsis</em&gt; Roots Gewebespezifische Zellwand Änderungen überwachen

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Amplification, Next-Generation-Sequenzierung und genomischer DNA Mapping von Retrovirale Integration Seiten

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Isolierung, Charakterisierung und hohem Durchsatz extrazelluläre Flux-Analyse der Maus primäre renale tubuläre Epithelzellen

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...