Name: high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots
Uploaded: 2016-04-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

Bu araştırma, Ulusal Bilim Vakfı Hibe IOS-1025642 (GBM) tarafından desteklenmiştir. Biz ARqua1 gerginlik sağlamak için Maria Harrison teşekkür ederiz.

1. Kılavuzu RNA Tasarım ve Vektör İnşaat <ol><li> ilgi genleri hedef sekansları tanımlamak. Bu adımda 13,14 için uygun çevrimiçi CRISPR hedef bulma çeşitli programlar vardır. NOT: Burada GN 20 GG hedef motifi kullanmak, ancak diğer tasarımlar kullanılan uygulama veya vektör sistemine bağlı olarak uygun olabilir. </li><li> Tasarım 60-mer gRNA oligo DNA montaj için gerekli olan 5 ile çevrili hedef motifleri &#39;ve 3&#39; 20 nt dizileri GN 19 bölümünü ka...

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

CRISPR ile hedeflenen DNA değişiklikleri oluşturmak için yeteneği / Cas9 işlevsel genomik çalışmalar için büyük bir potansiyele sahiptir. CRISPR / Cas9 sisteminin iki bileşeni vardır; Staphylococcus pyogenes ve hedefli DNA ekibi (s, 1) Cas9 yönlendiren bir yaklaşık 100 nt kılavuz RNA (gRNA) molekülünden türetilen Cas9 nükleaz. Hedef tanıma, ilk olarak haiz ~ hedefleme vektörleri 2,3 yüksek kapasiteli bir üretim sağlayan gRNA, 20-nt. Tasarlanmış olabilir Çoğu organizmalar, zaten CRISPR / Cas9 teknolojisi 4,5 ile olmuştur. Bitkiler, CaMV 35S promotörü gibi yapısal promotörler, in, genel olarak Cas9 nükleaz 6 ekspresyonunu tahrik etmek için kullanılır. gRNAs gRNA ilk taban kısıtlayan RNA polimeraz III U6 ya da U3 promoterler kullanılarak ifade edilir ya G, verimli bir transkripsiyon için U3 U6 veya A için. Ancak RNA polimeraz II baloBu kısıtlamaların ücretsiz oters, aynı zamanda 7,8 kullanılmıştır. Farklı gRNAs farklı verimlilik ile DNA mutasyonlarının neden, ve bu yüzden ilk olarak tüm fabrika dönüşümleri yatırım veya kapsamlı fenotipik ekranlar kurmadan önce CRISPR vektörleri doğrulamak için önemli olabilir. CRISPR geçici ifadesi zordur mutasyonlar ve bu yaklaşımlar ile pratik fenotipik deneylerinin algılama hale stabil bitkilerde 6 ile karşılaştırıldığında, genel olarak, DNA modifikasyon daha düşük bir frekans ile sonuçlanır örneğin agroinfiltration kullanarak, bitkilerde oluşturur. Sözde saçak kökler stabil bitkiler için ay karşı bağımsız kararlı bir şekilde transforme edilmiş bir malzeme çok sayıda hafta içinde oluşturulabilir çünkü uygun, alternatif sistem vardır. CRISPR vektörleri saçak kök 9,10 DNA mutasyonlarının uyaran çok etkilidir. DNA montaj yöntemleri etkin bir şekilde overl içeren DNA parçalarını birbirine bağlamakapping 11 sona erer. Bazı DNA düzeneği yöntemlerinin önemli bir avantajı birleştirilmiş ürünler haline ssDNA (yani, oligolar) dahil yeteneğidir. gRNAs yalnızca ~ 20 nt uzunluğunda ve yeni hedefler sentezlenen oligo yapılabilir için, bu DNA montaj yöntemleri CRISPR klonlama için de uygundur. Burada anlatılan protokollerin başarılı soya 10, kavak 12 kullanılan ve şu anda domates edilmiş CRISPR vektörlerinin P201 serisi dayanmaktadır. Sunulan klonlama işlemi geçerli klonlama yöntemiyle 10 üzerinde çeşitli avantajlar sunuyor. Yani, tam fonksiyonel vektörler tek bir gün içinde tek bir klonlama reaksiyonda oluşturulabilir. Vektör yapımı daha da eller üzerinde zaman ve malzeme maliyetleri azaltarak, paralel olarak birden fazla CRISPR vektörleri oluşturmak için toplanmış olabilir. Ayrıca hedef gen delesyonlu transjenik malzemeler üretmek için etkili bir yöntem olarak, domates saçak kök oluşumu için bir protokol mevcut. Saçak kök geçerlidir için kullanılırCRISPR vektörleri yedik ve daha sonraki deneyler için malzeme sağlamak.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

DNA, montaj ile CRISPR vektör oluşturulması, tipik olarak, bağımsız klondan On ila yüzlerce oluşturur. PCR ile koloni taraması kolayca doğru klonlar tanımlar ve ve sorun giderme için kullanışlıdır ekler (Şekil 2A) olmadan plazmidler ayırt edebilirsiniz. Tipik olarak, klonların hepsi bir ek içeren ve bir kullanıcı tamamen koloni tarama adımlarını atlamak için tercih edebilir. Teşhis dijestleri (Şekil 2B) ve Sanger dizileme kali...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Domates Tüylü Roots Üretimi ile yüksek verim CRISPR Vektör İnşaat ve DNA Değişiklikler Karakterizasyonu

DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

Research

JoVE Journal

Biology

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

RNA içeren Oligonükleotidler kullanarak Dönüşüm Genomik DNA, RNA / DNA Hibritlerin Üretimi

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: Büyüyen Bir Yöntem Arabidopsis</emYüksek Verim Genotiplendirme için 96-iyi Tabaklar ve Domates Tesisleri>

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

CRISPR / Cas Sistemleri Endonükleazlar için Substrat Üretimi

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

Yüksek verim Sıralama için Yüksek Kalite Kromatin Immunoprecipitation DNA Şablon üretimi (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

DNA Metilasyon Analizi nesil Dizilimine tarafından hedef

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Post-transkripsiyonel ayarlı genlerin kimyasal Modülatörler için yüksek verimli tarama

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DamID seq: Adenin-metillenmiş DNA Fragments Yüksek Verimli Dizileme tarafından Protein-DNA Etkileşimleri genom Haritalama

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Kristalin Selüloz Birikimin Yüksek Çözünürlüklü Niceleme<em&gt; Arabidopsis</em&gt; Kökler Doku spesifik Hücre Duvarı Değişiklikler Monitör

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviral Entegrasyon Siteleri Amplifikasyon, Yeni Nesil Sıralama ve Genomik DNA Haritalama

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Yalıtım, karakterizasyonu ve yüksek işlem hacmi ekstraselüler akı analiz fare birincil Renal tübüler epitel hücresi

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...