Name: circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr
Uploaded: 2016-06-26T14:00:00
Description: Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Støttet av midler fra den italienske foreningen for Cancer Research (AIRC) til MF (MFAG 11676) og MN (spesialprogram Molecular Clinical Oncology -. 5 promille n 9980, 2010/15) og fra den italienske Ministry of Instruction, Universitetet og forskning FIRB 2011 til MN (Prosjekt RBAPIIBYNP).

MikroRNA Isolasjon fra plasma eller serum Merk: Plasma og serum forberedelse er en relevant skritt i sirkulerende miRNA kvantifisering. Det er ingen spesiell prosedyre for plasma og serum forberedelse. Den eneste viktige ting å vurdere er at alle prøver fra samme eksperiment må behandles med nøyaktig den samme arbeidsflyten. Start fra 200 pl serum eller plasma. Total-RNA kan isoleres fra serum eller plasma ved anvendelse av kommersielt tilgjengelige sett. 1. Protokoll for Total RNA (...

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

Sirkulerende mirnas er til stede i blod i ekstremt lave konsentrasjoner, og mengden av RNA som kan utvinnes fra plasma og serumprøver er lav. Av denne grunn, er de vanskelig å kvantifisere med andre teknikker som microarray og RNA-sekvensering. Videre er det en generell mangel på enighet om data normalisering og tilstedeværelsen av endogene &quot;referanse&quot; mirnas i blodet. I denne sammenheng er en følsom teknologi som dråpe digital PCR, i stand til å telle antall miRNA kopier per ml serum eller plasma, selv...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Sirkulasjons (av cellefritt) microRNAs (mirnas) blir løslatt fra celler i blodet. Mengden av spesifikke microRNAs i kretsløpet har vært knyttet til en sykdomstilstand, og har potensiale til å bli brukt som biomarkør sykdom. En følsom og nøyaktig metode for å sirkulere mikroRNA kvantifisering ved anvendelse av en fargestoffbasert kjemi og dråpe digital PCR-teknologi har nylig blitt utviklet. Nærmere bestemt, ved å bruke Låst Nucleic Acid (LNA) -baserte miRNA-spesifikke primere med en grønn fluorescerende DNA-bindende fargestoff i et kompatibelt digitalt dråpe PCR system det er mulig å oppnå den absolutte kvantifisering av spesifikke miRNAs. Her beskriver vi hvordan utfører denne teknikk for å vurdere miRNA mengde i biologiske væsker, slik som plasma og serum, er både mulig og effektivt.

Den absolutte mengde av spesifikke mirnas pr ml plasma eller serum kan bestemmes ved hjelp av en grønn fluorescerende DNA-bindende fargestoff og dråpe digital PCR-teknologi. Figur 1 viser prosessen med positiv-dråper markering, som bestemmer den endelige miRNA konsentrasjon (kopier / ul ) i amplifikasjonsreaksjonen beregnet ved analyseprogramvare. Mengden av hver miRNA i blodet er svært forskjellige, blir noen miRNA arter rikere enn andre. Ved hjelp av en 1:50 fortyn...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Sirkulasjons mikroRNA Kvantifisering Bruke DNA-bindende Dye kjemi og Droplet Digital PCR

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

Research

JoVE Journal

Bioengineering

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Fluorescence detection methods for microfluidic droplet platforms

Fluorescens deteksjon metoder for microfluidic dråpe plattformer

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Deteksjon og Isolering av Sirkulerende Melanom Cells bruke photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Diagnosis of Neoplasia in Barrett&#8217;s Esophagus using Vital-dye Enhanced Fluorescence Imaging

Diagnosis of Neoplasia in BarrettÃƒÂ¢Ã¢â€šÂ¬Ã¢â€žÂ¢s Esophagus using Vital-dye Enhanced Fluorescence Imaging

Diagnose av Neoplasia i Barretts øsofagus med Vital-dye Forbedret Fluorescens Imaging

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Kvantifisering og Size-profilering av Ekstracellulær Blemmer Bruke Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

Multicolor Fluorescence Detection for Droplet Microfluidics Bruke optiske fibre

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as ...

A Method to Estimate Cadaveric Femur Cortical Strains During Fracture Testing Using Digital Image Correlation

En metode for å beregne Cadaveric Femur kortikale stammer under brudd Testing ved hjelp av digitalt bilde korrelasjon

This protocol describes the method using digital image correlation to estimate cortical strain from high speed video images of the cadaveric femoral ...

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy (DHM)

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy DHM

Kvantifisere mikroorganismer i lave konsentrasjoner bruker Digital holografiske mikroskopi (DHM)

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

En dråpe Microfluidic tilnærming og Microsphere PCR forsterkning for Single-strandet DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bulk Droplet Vitrification for Primary Hepatocyte Preservation

Bulk dråpe vitrifikasjon for primær hepatocytter bevaring

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. ...