Name: a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing
Uploaded: 2016-07-03T15:00:00
Description: Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

ملاحظة: انظر الشكل رقم 1 لمخطط من البروتوكول. تتطلب عدة خطوات والكواشف في البروتوكول تدابير السلامة (المشار إليها ب &quot;تنبيه&quot;). استشارة بيانات سلامة المواد قبل استخدامها. يتم تنفيذ كافة الخطوات بروتوكول في RT ما لم يرد البعض. <p class="jove_title" style=";text-align:right;directio...

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

هنا يوصف بروتوكول للأداء التقييم الوظيفي لكامل البروتين المكتبات التشبع الطفرات، وذلك باستخدام تكنولوجيا التسلسل الإنتاجية العالية. جانب هام من جوانب هذه الطريقة استخدام بادئات المتعامدة خلال عملية الاستنساخ. لفترة وجيزة، وعشوائية في كل موقف من الأحماض الأمينية ?...

منذ فترة طويلة استخدمت الطفرات في المختبر لدراسة خصائص النظم البيولوجية وتطورها، وإلى إنتاج بروتينات متحولة أو الكائنات الحية مع وظائف محسنة أو جديدة. في حين اعتمدت النهج في وقت مبكر على الطرق التي تنتج الطفرات العشوائية في الكائنات الحية، وظهور تكنولوجيا الحمض النووي المؤتلف تمكين الباحثين إلى إدخال تغييرات محددة على الحمض النووي بطريقة مواقع محددة، أي، الطفرات موقع الموجه 1،2. مع التقنيات الحالية، وعادة ما تستخدم أليغنوكليوتيد مطفرة في تفاعل البلمرة المتسلسل (PCR)، فمن سطحي نسبيا لإنشاء وتقييم أعداد صغيرة من الطفرات (على سبيل المثال، الطفرات نقطة) في جين معين 3،4. ومن أصعب بكثير ولكن عند اقتراب الهدف، على سبيل المثال، إنشاء وتقييم كل شيء ممكن في موقع واحد (أو أكثر حسب الطلب) الطفرات. في حين عرف الكثير من الدراسات في وقت مبكر محاولة لتقييم أعداد كبيرة من مكانت utations في الجينات التقنيات المستخدمة في كثير من الأحيان شاقة، على سبيل المثال تتطلب تقييم كل طفرة بشكل مستقل باستخدام هراء القامع سلالات 5-7، أو كانت محدودة في قدرتها الكمية نظرا لانخفاض عمق تسلسل سانجر تسلسل 8. وإلى حد كبير محل التقنيات المستخدمة في هذه الدراسات من قبل وسائل الاستفادة من الإنتاجية العالية التكنولوجيا التسلسل 9-12. هذه الطرق بسيطة من الناحية النظرية يؤدي الى ظهور مكتبة تضم عددا كبيرا من الطفرات، إخضاع المكتبة إلى الشاشة أو اختيار وظيفة، ثم أعماق تسلسل (أي، بناء على أمر من&gt; 10 6 التسلسل يقرأ) حصلت المكتبة قبل و بعد الاختيار. في هذه الطريقة، والمظهرية أو الملاءمة آثار عدد كبير من الطفرات، ممثلة على النحو التغيير في تردد السكان في كل متحولة، يمكن تقييمها في وقت واحد وأكثر من الكمية. قدمنا ​​سابقا المبسطة(. أي كامل البروتين المكتبات التشبع الطفرات) نهج جنيه لتقييم المكتبات من جميع الطفرات الأحماض الأمينية واحدة محتملة في البروتينات، التي تنطبق على الجينات مع طول أطول من التسلسل قراءة طول 11،13: أولا، كل موقف الأحماض الأمينية غير العشوائية بواسطة الموقع الموجه للطفرات PCR. وخلال هذه العملية، يتم تقسيم الجينات في مجموعات مكونة من مواقع متجاورة بطول إجمالي استيعابها عن طريق المنصة التسلسل. المنتجات PCR تسبب الطفرات الوراثية لكل مجموعة ثم يتم الجمع، وكل مجموعة تعرض بشكل مستقل لاختيار والتسلسل الإنتاجية العالية. من خلال المحافظة على المراسلات بين موقع الطفرات في تسلسل وطول تسلسل القراءة، وهذا النهج في الاستفادة من زيادة عمق التسلسل: في حين يمكن للمرء أن مجرد تسلسل هذه المكتبات في ويندوز قصيرة دون تقسيم إلى مجموعات (على سبيل المثال، عن طريق بندقية القياسية. نهج التسلسل)، فإن معظم القراءات التي تم الحصول عليها سيكون من النوع البري، وبالتالي مajority من الإنتاجية تسلسل يضيع (على سبيل المثال، لمكتبة التشبع الطفرات كامل البروتين من بروتين حمض أميني 500 التسلسل في 100 حمض أميني (300 بي بي) ويندوز، في الحد الأدنى 80٪ من يقرأ ستكون من النوع البري تسلسل). هنا، يتم تقديم البروتوكول الذي يستخدم الإنتاجية العالية التسلسل لتقييم وظيفي من كامل البروتين المكتبات التشبع الطفرات، وذلك باستخدام النهج المذكور أعلاه (الموضحة في الشكل 1). الأهم من ذلك، نحن نقدم استخدام بادئات المتعامدة في عملية الاستنساخ من المكتبة لالباركود كل مجموعة التسلسل، والذي يسمح لها أن تكون المضاعفة في مكتبة واحدة، تخضع في نفس الوقت لفحص أو اختيار، ومن ثم إزالة المضاعفة لتسلسل عميق. منذ لا يتم إخضاع الجماعات تسلسل لاختيار مستقل، وهذا يقلل من عبء العمل ويضمن أن كل طفرة يواجه نفس المستوى من الاختيار. تيم-1 β-اكتاماز، وهو الانزيم الذي يمنح مقاومة رفيع المستوى لوتستخدم المضادات الحيوية β لاكتام (على سبيل المثال، الأمبيسلين) في البكتيريا كنظام نموذج 14-16. يوصف بروتوكول لتقييم مكتبة الطفرات تشبع كامل البروتين من تيم-1 في E. القولونية تحت الاختيار في مستوى مصل تقريبي لجرعة سريرية من الأمبيسلين (50 ميكروغرام / مل) 17،18.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

يظهر - (pBR322_OP5 pBR322_OP1) في الشكل 2A خريطة البلازميد لخمسة البلازميدات pBR322 المعدلة تحتوي على مواقع فتيلة المتعامدة. لاختبار ما إذا الاشعال المتعامدة محددة، أجريت تقارير إتمام المشروعات باستخدام كل زوج من الاشعال المتعامدة على حدة، جنبا إلى جنب ...

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

نقدم بروتوكول للتقييم الوظيفي للمكتبات موقع واحد التشبع الطفرات شاملة من البروتينات باستخدام الإنتاجية العالية التسلسل. الأهم من ذلك، يستخدم هذا النهج أزواج التمهيدي متعامدة مع تعدد بناء مكتبة والتسلسل. وتقدم ممثل النتائج باستخدام تيم-1 β-اكتاماز المختارة في جرعة ذات الصلة سريريا من الأمبيسلين.

بروتوكول لالتقييم الوظيفي من كامل البروتين التشبع الطفرات المكتبات الاستفادة من الإنتاجية العالية التسلسل

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Research

JoVE Journal

Biology

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

الطفرات والتحليل الوظيفي للقنوات ايون أعربت Heterologously في خلايا الثدييات

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

شاشة إنتاجية عالية للنشاط Biomining سلولاز من مكتبات Metagenomic

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

بروتوكولات اختيار الطفرات وظيفية لتطور المخرج من البروتينات في E. القولونية</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

Competitive Genomic Screens of Barcoded Yeast Libraries

الجينوم شاشات التنافسية للمكتبات الخميرة Barcoded

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

استخدام روبوت لارتفاع الإنتاجية البلورة من بروتينات الغشاء في Mesophases شحمي

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

الكيمياء الحيوية والعليا تقييم مجهرية مرت من كتلة الدهون في<em&gt; Caenorhabditis ايليجانس</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

الإنتاجية العالية فحص وظيفية باستخدام محلية الصنع ثنائي توهج luciferase الفحص

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

جيل من جودة عالية لونين القالب الحمض النووي مناعي لتسلسل عالية الإنتاجية (رقاقة وما يليها)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

High Throughput Microinjections of Sea Urchin Zygotes

عالية الإنتاجية إبر دقيقة جدا لقنفذ البحر بيضات ملقحة

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

ربط ذات كفاءة عالية من الحمض النووي الريبي الجزيئات الصغيرة لالرنا الميكروي الكميات من قبل التسلسل الإنتاجية العالية

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...