Name: a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing
Uploaded: 2016-07-03T15:00:00
Description: Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

Hinweis: Siehe Abbildung 1 für Umriss des Protokolls. Mehrere Schritte und Reagenzien, die in dem Protokoll erfordern Sicherheitsmaßnahmen (mit &quot;Vorsicht&quot; gekennzeichnet). Wenden Sie Sicherheitsdatenblätter vor dem Gebrauch. Alle Protokollschritte werden bei RT, sofern nicht andere angegeben. 1. Bereiten Sie Kultur, Medien und Platten <ol><li> Vorbereiten und Sterilisieren durch Autoklavieren 1 L gereinigtes Wasser, 100 ml SOB-Medium (SOB; Tabelle 1),<...

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

Hier ist ein Protokoll zum Durchführen der funktionellen Bewertung des gesamten protein Sättigungsmutagenese Bibliotheken beschriebenen Hochdurchsatz-Sequenzierung Technologie. Ein wichtiger Aspekt des Verfahrens ist die Verwendung von orthogonalen Primern während des Klonens. Kurz gesagt, wird jede Aminosäureposition durch mutagene PCR randomisiert, und zusammen in Gruppen von Positionen, deren kombinierte Sequenzlänge von Hochdurchsatz-Sequenzierung untergebracht ist gemischt. Diese Gruppen kloniert in Plasmid-Ve...

Mutagenese wurde lange im Labor verwendet worden, um die Eigenschaften von biologischen Systemen und ihre Entwicklung zu studieren, und mutierte Proteine ​​oder Organismen mit verbesserten oder neuen Funktionen zu erzeugen. Während die ersten Ansätze auf Methoden verlassen , die in Organismen zufällige Mutationen erzeugen, Forscher das Aufkommen der rekombinanten DNA - Technologie ermöglicht die Einführung wählen Änderungen an DNA in einer ortsspezifisch, dh., Ortsgerichtete Mutagenese 1,2. Mit den derzeitigen Techniken, typischerweise unter Verwendung von mutagenen Oligonukleotide in einer Polymerase - Kettenreaktion (PCR) ist es relativ leicht zu erzeugen und zu bewerten , eine kleine Anzahl von Mutationen (z. B. Punktmutationen) in einem gegebenen Gen 3,4. Es ist viel schwieriger, aber wenn das Ziel Ansätze, zum Beispiel die Erstellung und Bewertung aller möglichen Single-Site (oder höherer Ordnung) Mutationen. Während ein Großteil wurde von frühen Studien gelernt Versuch, eine große Zahl von m zu beurteilenutations in Genen, die verwendeten Techniken waren oft mühsam, zum Beispiel die Bewertung der einzelnen Mutation erfordern eine unabhängige Verwendung von Nonsense - Suppressor - Stämmen 5-7, oder sie wurden in ihrer quantitativen Fähigkeit aufgrund der geringen Sequenzierungstiefe von Sanger - Sequenzierung 8 begrenzt. Die Techniken , die in diesen Studien verwendet wurden weitgehend durch Verfahren ersetzt worden 9-12 High-Throughput - Sequenzierung Technologie. Diese konzeptionell einfache Ansätze zur Folge Erstellen einer Bibliothek , die eine große Anzahl von Mutationen umfasst, Unterwerfen der Bibliothek an einen Bildschirm oder eine Auswahl für die Funktion und dann tief Sequenzierung (dh. In der Größenordnung von&gt; 10 6 Sequenzierung liest) die Bibliothek erhalten vor und nach der Auswahl. Auf diese Weise können die phänotypische oder Eignung Wirkungen einer großen Anzahl von Mutationen, wie die Änderung in Bevölkerungsfrequenz jedes mutanten dargestellt, bewertet werden, um gleichzeitig und quantitativ. Wir führten zuvor eine einfa(. dh Ganz Protein Sättigungsmutagenese - Bibliotheken) le Ansatz für Bibliotheken aller möglichen einzelnen Aminosäure - Mutationen in Proteinen Beurteilung für Gene mit einer Länge länger als die Sequenzierung lesen Länge 11,13: Zuerst wird jede Position Aminosäure randomisierten durch ortsgerichtete mutagene PCR. Während dieses Prozesses wird das Gen in Gruppen aufgeteilt, bestehend aus zusammenhängenden Positionen mit einer Gesamtlänge von der Sequenzierungs Plattform untergebracht sind. Die mutagene PCR-Produkte für jede Gruppe werden dann kombiniert, und jede Gruppe unabhängig voneinander zur Auswahl und Hochdurchsatz-Sequenzierung unterzogen. Durch die Aufrechterhaltung hat eine Entsprechung zwischen der Position von Mutationen in der Sequenz und die Sequenzierung Leselänge dieser Ansatz den Vorteil der Maximierung Sequenzierungstiefe: während man einfach könnte sequenzieren solche Bibliotheken in kurzen Fenstern ohne Aufteilung in Gruppen (beispielsweise durch eine Standard - Schrotflinte. Sequenzierung Ansatz), die meisten liest wäre erhaltenen Wildtyp und damit die majority von Sequenzierungsdurchsatz verschwendet (beispielsweise für ein ganzes Protein Sättigungsmutagenese Bibliothek eines Proteins 500 Aminosäure in 100 Aminosäure sequenziert (300 bp) Fenster, bei mindestens 80% der liest , wird die Wildtyp - Sequenz ist). Hier wird ein Protokoll vorgestellt , das Hochdurchsatz - Sequenzierung für die funktionelle Beurteilung des gesamten Protein - Sättigungsmutagenese - Bibliotheken verwendet, die obige Ansatz (skizziert in Abbildung 1). Wichtig ist, stellen wir die Verwendung von orthogonalen Primern in der Bibliothek Klonierungsverfahren jede Sequenzgruppe zu Barcode, der sie in einer Bibliothek gemultiplext werden können, gleichzeitig Screening oder Selektion unterzogen und dann für tiefe Sequenzierung demultiplexiert. Da die Sequenzgruppen nicht unabhängig Selektion unterzogen werden, verringert sich die Arbeitsbelastung und stellt sicher, dass jede Mutation, das gleiche Niveau der Auswahl erfährt. TEM-1-β-Lactamase, ein Enzym, das auf hohem Niveau Resistenz verleihtβ-Lactam - Antibiotika (z. B. Ampicillin) in Bakterien wird als Modellsystem 14-16 verwendet. Ein Protokoll wird für die Beurteilung der Gesamtprotein Sättigungsmutagenese Bibliothek von TEM-1 in E. beschrieben coli unter Selektion bei einer ungefähren Serumspiegel für eine klinische Dosis von Ampicillin (50 ug / ml) 17,18.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

Die Plasmid - Karte für die fünf modifizierten pBR322 Plasmiden , die orthogonal Primingstellen (pBR322_OP1 - pBR322_OP5) ist in 2A gezeigt. Um zu testen, ob die orthogonal Primer sind spezifisch, PCRs wurden durchgeführt, um jedes Paar von orthogonalen Primer einzeln, zusammen mit allen fünf pBR322_OP1-5 Plasmiden oder mit allen Plasmiden minus dem Plasmid, das das orthogonale Primerpaars entspricht. Die richtige Produkt wurde nur erhalten , wenn die passenden Plasm...

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Wir stellen ein Protokoll für die funktionelle Bewertung umfassender single-site Sättigungsmutagenese Bibliotheken von Proteinen Hochdurchsatz-Sequenzierung verwendet. Wichtig ist, nutzt dieser Ansatz orthogonalen Primerpaare Bibliothek Konstruktion und Sequenzierung zu multiplexen. Repräsentative Ergebnisse unter Verwendung von TEM-1 β-Lactamase in klinisch relevanter Dosierung von Ampicillin ausgewählt werden bereitgestellt.

Ein Protokoll für Functional Assessment of Whole-Protein Sättigungsmutagenese-Bibliotheken mit Hilfe von High-Throughput Sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Research

JoVE Journal

Biology

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

Mutagenese und funktionale Analyse von Ionenkanälen heterolog in Säugerzellen exprimierten

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

Forschung

Biologie

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

Ein High-Throughput-Screen für Biomining Cellulase Aktivität von Metagenombanken

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenese und Functional Selection Protocols for Directed Evolution von Proteinen in E. coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

Competitive Genomic Screens of Barcoded Yeast Libraries

Competitive Genomic Screens von Barcoded Hefe Bibliotheken

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Einsatz eines Roboters für High-Throughput-Kristallisation von Membranproteinen in Lipidische Mesophasen

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biochemische und High Throughput Mikroskopische Beurteilung der Fettmasse in<em&gt; Caenorhabditis elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

Hochdurchsatz-Screening mit einem Funktionshomemade Dual-Luciferase Assay-Schein

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

Generierung von High Quality Chromatin Immunpräzipitation DNA Vorlage für Hochdurchsatz-Sequenzierung (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

High Throughput Microinjections of Sea Urchin Zygotes

Hochdurchsatz-Mikroinjektionen von Sea Urchin Zygotes

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

Hoch effiziente Ligation kleine RNA-Moleküle für MicroRNA Quantifizierung von Hochdurchsatz-Sequenzierung

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...