Name: a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing
Uploaded: 2016-07-03T15:00:00
Description: Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

הערה: ראה איור 1 עבור קווי המתאר של הפרוטוקול. צעדים ריאגנטים כמה בפרוטוקול דורשים אמצעי בטיחות (מסומנים עם &quot;זהירות&quot;). התייעץ גיליונות נתוני בטיחות חומרים לפני השימוש. כל צעדי הפרוטוקול מבוצעים ב RT אלא אם כן זה צביעה. 1....

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

הנה פרוטוקול מתואר לביצוע ההערכה התפקודית של ספריות mutagenesis רווי כולה חלבון, באמצעות טכנולוגיית ריצוף תפוקה גבוהה. היבט חשוב של השיטה הוא השימוש פריימרים מאונך במהלך תהליך השיבוט. בקצרה, כל עמדת חומצת אמינו היא אקראית על ידי מוטגנים PCR, ו מעורבת יחד לקבוצות של עמדות בש?...

Mutagenesis הועסק ארוך במעבדה כדי ללמוד את המאפיינים של מערכות ביולוגיות האבולוציה שלהם, ועל מנת לייצר חלבונים או אורגניזמים מוטנטים עם פונקציות משופרות או רומן. בעוד גישות מוקדם הסתמכו על שיטות אשר מייצרים מוטציות אקראיות באורגניזמים, הופעתו של טכנולוגיית ה- DNA רקומביננטי אפשרה לחוקרים להציג שינויים בחר DNA באופן אתר ספציפי, כלומר., 1,2 mutagenesis באתר ביים. בעזרת טכניקות נוכחיות, בדרך כלל באמצעות oligonucleotides מוטגנים ב תגובת שרשרת פולימראז (PCR), הוא יחסית קליל ליצור ולהעריך מספר קטן של מוטציות (למשל., מוטציות נקודתיות) בגן מסוים 3,4. זה הרבה יותר קשה אולם כאשר גישות המטרה, למשל, יצירה וההערכה של כל האתר היחיד האפשרי (או מסדר גבוה) מוטציות. בעוד הרבה כבר למדו מן המחקרים המוקדמים מנסה להעריך במספרים גדולים של מ &#39;utations בגנים, הטכניקות המשמשות היו לעתים קרובות מייגעות, למשל המחייב את הערכה של כל מוטציה באמצעות מדכא שטויות עצמאי זני 5-7, או היו מוגבלים ביכולת הכמותית שלהם בשל עומק הרצף הנמוך של סנגר רצף 8. הטכניקות בשימוש במחקרים אלה כבר החליפו במידה רבה על ידי שיטות ניצול טכנולוגית רצף תפוקה גבוהה 9-12. גישות פשוטות מושגית אלה כרוכים יצירת ספרייה הכוללת מספר רב של מוטציות, משעבדת את הספרייה למסך או מבחר לתפקוד, ולאחר מכן-רצף עמוק (כלומר., בסדר גודל של&gt; 10 6 רצף כניסות) הספרייה שהושגה לפני לאחר הבחירה. בדרך זו, את ההשפעות פנוטיפי או התאמה של מספר רב של מוטציות, ייצגו כשינוי בתדירות אוכלוסייה של כל מוטציה, ניתן להעריך בו זמנית ועוד כמותית. בעבר הצגנו פתי(. כלומר, ספריות mutagenesis הרוויה כולה חלבון) הגישה le להערכת ספריות של כל המוטציות חומצה אמינית אחת אפשרית חלבונים, החלים על גנים עם אורך זמן רב יותר מאשר רצף לקרוא אורך 11,13: ראשית, כל עמדה חומצות אמיניות הוא אקראי על ידי אתר מכוון PCR מוטגנים. במהלך תהליך זה, גן מחולק קבוצות המורכבות עמדות רציפות באורך כולל לאכלס ידי פלטפורמת הרצף. מוצרי PCR מוטגנים לכל קבוצה מצורפים יחד, וכל קבוצה נתונה עצמאי בחירת רצף תפוקה גבוהה. על ידי שמירה על התכתבות בין המיקום של מוטציות ברצף והאורך לקריאת הרצף, גישה זו יש את היתרון של עומק רצף למקסם: בעוד אחד יכול פשוט רצף ספריות כאלה בחלונות קצרים ללא פיצול לקבוצות (למשל, על ידי רובה רגיל. גישת רצף), רוב הקורא המתקבל יהיה סוג-פרא ולכן מajority של תפוקת רצף המבוזבזת (למשל, עבור ספריית mutagenesis רווי כולה חלבון של חלבון חומצת אמינו 500 רצף ב 100 חומצות אמיניות (300 חלונות נ&quot;ב), לכל הפחות 80% של הקורא יהיה רצף wild-type). כאן, פרוטוקול מוצג אשר מנצל רצף תפוקה גבוהה עבור ההערכה התפקודית של ספריות mutagenesis רווי כולה חלבון, בגישה לעיל (המתואר באיור 1). חשוב לציין, אנחנו מציגים את השימוש של פריימרים מאונכים בתהליך שיבוט הספרייה ברקוד כל קבוצת רצף, אשר מאפשרת להם להיות מרובבות לתוך ספרייה אחד, נתון בו זמנית כדי הקרנה או בחירה, ולאחר מכן דה-מרובב על רצף עמוק. מאחר שקבוצות הרצף אינן חשופות בחירה באופן עצמאי, זה מפחית את עומס העבודה ומבטיח שכל מוטציה חווה את אותה רמת בחירה. TEM-1 β-lactamase, אנזים אשר מקנה עמידות גבוהה ברמהβ-לקטם אנטיביוטיקה (למשל., אמפיצילין) בחיידקים משמשת כמערכת מודל 14-16. פרוטוקול מתואר להערכת ספריית mutagenesis רווי כולה החלבון של TEM-1 ב E. coli תחת בחירה ברמה בסרום משוערת עבור מנה קלינית של אמפיצילין (50 מיקרוגרם / מיליליטר) 17,18.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

מפת פלסמיד במשך חמשת פלסמידים pBR322 השונים המכילים אתרים יחולו אורתוגונלי (pBR322_OP1 - pBR322_OP5) מוצגת באיור 2 א. כדי לבדוק אם פריימרים המאונכים הם ספציפיים, PCRs בוצע באמצעות כל זוג פריימרים מאונך בנפרד, יחד עם כל חמשת פלסמידים pBR322_OP1-5, או עם כל פלסמידי?...

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

אנו מציגים פרוטוקול עבור ההערכה התפקודית של ספריות mutagenesis רווי אתר יחיד המקיפות של חלבוני ניצול רצף תפוקה גבוהה. חשוב לציין, גישה זו משתמשת זוגות פריימר מאונכים לבצע ריבוב בניית רצף ספרייה. תוצאות נציג באמצעות TEM-1 β-lactamase שנבחר במינון רלוונטי קליני של אמפיצילין מסופקות.

פרוטוקול והערכה תפקודית של ספריות mutagenesis רווית Whole-חלבון ניצול רצף תפוקה גבוהה

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Research

JoVE Journal

Biology

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

Mutagenesis וניתוח פונקציונלי של תעלות יונים הביעו Heterologously בתאי יונקים

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

מסך התפוקה גבוהה עבור Biomining פעילות cellulase מספריות Metagenomic

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

בחירת הפרוטוקולים mutagenesis ו פונקציונאלי אבולוציה מכוונת של חלבונים א coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

Competitive Genomic Screens of Barcoded Yeast Libraries

מסכי הגנום תחרותי של ספריות שמרים המבורקדים

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

שימוש ברובוט להתגבשות תפוקה גבוהה של חלבונים בממברנה בMesophases Lipidic

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

הערכה ביוכימית ותפוקה גבוהה מיקרוסקופית של מסת שומן ב<em&gt; Elegans Caenorhabditis</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

הקרנה פונקציונלית תפוקה גבוהה באמצעות assay בלוציפראז Dual-זוהר תוצרת בית

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

דור של תבנית הכרומטין immunoprecipitation איכות גבוהה עבור ה-DNA רצף תפוקה גבוהה (שבב ואילך)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

High Throughput Microinjections of Sea Urchin Zygotes

התפוקה microinjections גבוה של zygotes קיפודי הים

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

קשירת יעילה ביותר של RNA קטן מולקולות לMicroRNA Quantitation על ידי רצף תפוקה גבוהה

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...