Name: a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing
Uploaded: 2016-07-03T15:00:00
Description: Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.

Merk: Se figur 1 for omrisset av protokollen. Flere trinn og reagenser i protokollen krever sikkerhetstiltak (indikert med &quot;FORSIKTIG&quot;). Størst sikkerhetsdatablad før bruk. Alle protokoll trinn utføres ved romtemperatur med mindre annet er angitt. 1. Forbered Kultur Media og Plates <ol><li> Fremstille og sterilisere ved autoklavering 1 l renset vann, 100 ml Super Optimal Broth (SOB, tabell 1), en L-Luria-Bertani-medium (LB, tabell 2),<...

<ol>
	<li>Hutchison, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutagenesis+at+a+specific+position+in+a+DNA+sequence.">Mutagenesis at a specific position in a DNA sequence.</a> J Biol Chem. 253 (18), 6551-6560 (1978).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+mutagenesis+in+one+day+with+&gt;80%+efficiency.">Site-directed mutagenesis in one day with &gt;80% efficiency.</a> Strategies. 9 (3), 3-4 (1996).</li><li>Higuchi, R., Krummel, B., Saiki, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+of+in+vitro+preparation+and+specific+mutagenesis+of+DNA+fragments:+study+of+protein+and+DNA+interactions.">A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.</a> Nucleic Acids Res. 16 (15), 7351-7367 (1988).</li><li>Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+mutation+of+bacteriophage+T4+lysozyme.">Systematic mutation of bacteriophage T4 lysozyme.</a> J Mol Biol. 222 (1), 67-88 (1991).</li><li>Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIV.+Analysis+of+4000+altered+Escherichia+coli+lac+repressors+reveals+essential+and+non-essential+residues,+as+well+as+'spacers'+which+do+not+require+a+specific+sequence.">Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as 'spacers' which do not require a specific sequence.</a> J Mol Biol. 240 (5), 421-433 (1994).</li><li>Kleina, L. G., Miller, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+studies+of+the+lac+repressor.+XIII.+Extensive+amino+acid+replacements+generated+by+the+use+of+natural+and+synthetic+nonsense+suppressors.">Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors.</a> J Mol Biol. 212 (2), 295-318 (1990).</li><li>Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amino+acid+sequence+determinants+of+beta-lactamase+structure+and+activity.">Amino acid sequence determinants of beta-lactamase structure and activity.</a> J Mol Biol. 258 (4), 688-703 (1996).</li><li>Fowler, D. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+mapping+of+protein+sequence-function+relationships.">High-resolution mapping of protein sequence-function relationships.</a> Nat Methods. 7 (9), 741-746 (2010).</li><li>Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+illumination+of+a+fitness+landscape.">Experimental illumination of a fitness landscape.</a> Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).</li><li>McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+spatial+architecture+of+protein+function+and+adaptation.">The spatial architecture of protein function and adaptation.</a> Nature. 491 (7422), 138-142 (2012).</li><li>Deng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+sequencing+of+systematic+combinatorial+libraries+reveals+beta-lactamase+sequence+constraints+at+high+resolution.">Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution.</a> J Mol Biol. 424 (3-4), 150-167 (2012).</li><li>Stiffler, M. A., Hekstra, D. R., Ranganathan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolvability+as+a+Function+of+Purifying+Selection+in+TEM-1+beta-Lactamase.">Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase.</a> Cell. 160 (5), 882-892 (2015).</li><li>Matagne, A., Lamotte-Brasseur, J., Frere, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Catalytic+properties+of+class+A+beta-lactamases:+efficiency+and+diversity.">Catalytic properties of class A beta-lactamases: efficiency and diversity.</a> Biochem J. 330 (Pt2), 581-598 (1998).</li><li>Salverda, M. L., De Visser, J. A., Barlow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+evolution+of+TEM-1+beta-lactamase:+experimental+reconstruction+and+clinical+relevance.">Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance.</a> FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).</li><li>Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Darwinian+evolution+can+follow+only+very+few+mutational+paths+to+fitter+proteins.">Darwinian evolution can follow only very few mutational paths to fitter proteins.</a> Science. 312 (5770), 111-114 (2006).</li><li>Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+levels+in+sputum,+serum,+and+saliva.">Ampicillin levels in sputum, serum, and saliva.</a> Thorax. 25 (3), 304-311 (1970).</li><li>Giachetto, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ampicillin+and+penicillin+concentration+in+serum+and+pleural+fluid+of+hospitalized+children+with+community-acquired+pneumonia.">Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia.</a> Pediatr Infect Dis J. 23 (7), 625-629 (2004).</li><li>Ambler, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+numbering+scheme+for+the+class+A+beta-lactamases.">A standard numbering scheme for the class A beta-lactamases.</a> Biochem J. 276 (Pt 1), 269-270 (1991).</li><li>Magoc, T., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH:+fast+length+adjustment+of+short+reads+to+improve+genome+assemblies).">FLASH: fast length adjustment of short reads to improve genome assemblies).</a> Bioinformatics. 27 (21), 2957-2963 (2011).</li><li>Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+mutational+scanning+of+an+RRM+domain+of+the+Saccharomyces+cerevisiae+poly(A)-binding+protein.">Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein.</a> RNA. 19 (11), 1537-1551 (2013).</li><li>Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+survey+of+an+intragenic+epistatic+landscape.">A systematic survey of an intragenic epistatic landscape.</a> Mol Biol Evol. 32 (1), 229-238 (2015).</li><li>Dove, S. L., Joung, J. K., Hochschild, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+prokaryotic+transcription+through+arbitrary+protein-protein+contacts.">Activation of prokaryotic transcription through arbitrary protein-protein contacts.</a> Nature. 386 (6625), 627-630 (1997).</li><li>Romero, P. A., Tran, T. M., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+enzyme+function+with+microfluidic-based+deep+mutational+scanning.">Dissecting enzyme function with microfluidic-based deep mutational scanning.</a> Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).</li></ol>

Her en protokoll er beskrevet for utførelse av funksjonell vurdering av hel-protein metning mutagenese biblioteker, ved hjelp av high-throughput sekvenseringsteknologi. Et viktig aspekt ved fremgangsmåten er bruken av ortogonale primere under kloningsprosessen. I korthet, blir hver aminosyre stilling randomisert av mutagene PCR, og blandet sammen i grupper av stillinger som kombinert sekvenslengde opptas av high-throughput-sekvensering. Disse gruppene er klonet inn i plasmidvektorer inneholdende par av ortogonale grun...

Mutagenese har lenge vært ansatt i laboratoriet for å studere egenskapene til biologiske systemer og deres utvikling, og å produsere mutante proteiner eller organismer med forbedrede eller nye funksjoner. Mens tidlige tilnærminger avhengig av metoder som produserer tilfeldige mutasjoner i organismer, bruk av rekombinant DNA-teknologi aktivert forskerne å innføre enkelte endringer i DNA i en stedsspesifikk måte, ie., Seterettet mutagenese 1,2. Med dagens teknikker, typisk ved hjelp av mutagene oligonukleotider i en polymerase kjedereaksjon (PCR), er det relativt lett å lage og vurdere et lite antall mutasjoner (f.eks., Punktmutasjoner) i et gitt gen 3,4. Det er langt mer vanskelig men når målet nærmer seg, for eksempel etablering og vurdering av alle mulige enkeltsted (eller høyere orden) mutasjoner. Selv om mye har blitt lært fra tidlige studier som forsøker å vurdere et stort antall mutations i gener, de teknikker som ble brukt var ofte arbeidskrevende, for eksempel krever vurdering av hver mutasjon uavhengig ved hjelp nonsense suppressor-stammer 5-7, eller var begrenset i sin evne til kvantitativt på grunn av den lave sekvense dybden av Sanger-sekvensering 8. Teknikkene som brukes i disse studiene har i stor grad blitt erstattet av metoder som benytter high-throughput sekvenseringsteknologi 9-12. Disse konseptuelt enkle fremgangsmåter innebærer å lage et bibliotek som omfatter et stort antall mutasjoner, underkaste biblioteket til en skjerm eller et valg for funksjon, og deretter dyp-sekvensering (f.eks., Av størrelsesorden&gt; 10 6 sekvense leser) biblioteket erholdt før og etter valget. På denne måte de fenotypiske eller egnethet virkningen av et stort antall mutasjoner, fremstilt som endringen i populasjonen frekvensen for hver mutant, kan vurderes samtidig og mer kvantitativt. Vi har tidligere innført en enkel og effekt(., dvs. hel-protein metning mutagenese biblioteker) le metode for vurdering av biblioteker av alle mulige enkeltaminosyrer mutasjoner i proteiner, som gjelder for gener med en lengde lenger enn det sekvense lese lengde 11,13: For det første er hver aminosyre posisjon randomisert ved seterettet mutagene PCR. Under denne prosessen blir genet delt inn i grupper bestående av sammenhengende stillinger med en total lengde opptas av sekvenseringsplattformen. De mutagene PCR-produktene for hver gruppe blir deretter kombinert, og hver gruppe uavhengig underkastet seleksjon og high-throughput-sekvensering. Ved å opprettholde en korrespondanse mellom plasseringen av mutasjoner i sekvensen og sekvenselese lengde, har denne tilnærmingen fordelen av å maksimere sekvense dybde: mens man kunne bare sekvensere slike biblioteker i korte vinduer uten å splitte opp i grupper (for eksempel ved en standard hagle. sekvense metoden), mest leser erholdt ville være villtype og dermed majority av sekvense gjennomstrømning til spille (dvs. for et hel-protein metning mutagenese-bibliotek fra et 500 aminosyreprotein sekvensert i 100 aminosyre (300 bp) vinduer, ved minst 80% av leser vil være vill-type-sekvensen). Her blir en protokoll presentert som anvender high-throughput-sekvensering for den funksjonelle vurderingen av hel-protein metning mutagenese biblioteker, ved hjelp av ovennevnte metode (beskrevet i figur 1). Viktigere, innfører vi bruk av ortogonale primere i biblioteket kloningsprosess til å strekkode hver sekvens gruppe, som tillater dem å bli multiplekset inn ett bibliotek, utsettes samtidig til screening eller utvalg, og deretter de-multiplekset for dyp sekvensering. Siden sekvens grupper ikke utsettes for valg uavhengig, dette reduserer arbeidsmengden, og sikrer at hver mutasjon opplever det samme nivået av utvalget. TEM-1 β-laktamase, et enzym som gir høyt nivå resistens motβ-laktam-antibiotika (f.eks. ampicillin) i bakterier er brukt som et modellsystem 14-16. En protokoll er beskrevet for vurdering av en hel-protein metning mutagenese bibliotek av TEM-1 i E. coli etter valg med en omtrentlig serumnivå for en klinisk dose av ampicillin (50 ug / ml) 17,18.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Typtone</td>
			<td style="width:259px;">Research Products Intl. Corp.</td>
			<td style="width:271px;">T60060-1000.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Yeast extract</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">Y20020-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Sodium chloride</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP358-212</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Potassium chloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">P9333-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnesium sulfate</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">M7506-500G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">BP1423-500</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tetracycline hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td style="width:271px;">T7660-5G</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">petri plates</td>
			<td>Corning</td>
			<td style="width:271px;">351029</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MATLAB&#160;</td>
			<td>Mathworks</td>
			<td style="width:271px;">http://www.mathworks.com/products/matlab/</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Oligonucleotide primers</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:271px;">https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos</td>
			<td style="width:271px;">25 nmol scale, standard desalting</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_AvrII</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">pBR322_OP1 &#8211; pBR322_OP5</td>
			<td>available upon request</td>
			<td style="width:271px;"></td>
			<td style="width:271px;">five modified pBR322 plasmids each containing a pair of orthogonal priming sites</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Q5 high-fidelity DNA polymerase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0491L</td>
			<td style="width:271px;">includes 5X PCR buffer and PCR additive (GC enhancer)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">15 mL conical tube</td>
			<td>Corning</td>
			<td style="width:271px;">430025</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Multichannel pipettes (Eppendorf ResearchPlus)</td>
			<td>Eppendorf</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">PCR plate, 96 well</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">14230232</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">96 well plate seal</td>
			<td>Excel Scientific</td>
			<td style="width:271px;">F-96-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Veriti 96-well thermal cycler</td>
			<td>Applied Biosystems</td>
			<td style="width:271px;">4375786</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">6X gel loading dye</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">B7024S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose</td>
			<td>Research Products Intl. Corp.</td>
			<td style="width:271px;">20090-500.0</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ethidium bromide</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">161-0433</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">UV transilluminator (FOTO/Analyst ImageTech)</td>
			<td>Fotodyne Inc.</td>
			<td style="width:271px;">http://www.fotodyne.com/content/ImageTech_gel_documentation</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EB buffer</td>
			<td>Qiagen</td>
			<td style="width:271px;">19086</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">96-well black-walled, clear bottom assay plates</td>
			<td>Corning</td>
			<td style="width:271px;">3651</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Lambda phage DNA</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">N3011S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">PicoGreen dsDNA reagent</td>
			<td>Invitrogen</td>
			<td style="width:271px;">P7581</td>
			<td style="width:271px;">dsDNA quantitation reagent, used in protocol step 2.2.4</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Victor 3V microplate reader</td>
			<td>PerkinElmer</td>
			<td style="width:271px;"></td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA purification kit</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Microcentrifuge tubes</td>
			<td>Corning</td>
			<td style="width:271px;">3621</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Long-wavelength UV illuminator</td>
			<td>Fisher Scientific</td>
			<td style="width:271px;">FBUVLS-80</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agarose gel DNA extraction buffer</td>
			<td>Zymo Research</td>
			<td style="width:271px;">D4001-1-100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AatII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0117S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AvrII</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">R0174L</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td style="width:271px;">M0202S</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">EVB100 electrocompetent E. coli</td>
			<td>Avidity</td>
			<td style="width:271px;">EVB100</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporator (E. coli Pulser)</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">1652102</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Electroporation cuvettes</td>
			<td>Bio-Rad</td>
			<td style="width:271px;">165-2089</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Spectrophotometer (Ultrospec 3100 pro)</td>
			<td>Amersham Biosciences</td>
			<td style="width:271px;">80211237</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">50 mL conical tubes</td>
			<td>Corning</td>
			<td style="width:271px;">430828</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasmid purification kit</td>
			<td>Macherey-Nagel</td>
			<td style="width:271px;">740588.25</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">8 well PCR strip tubes</td>
			<td>Axygen</td>
			<td style="width:271px;">321-10-551</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit dsDNA HS assay kit</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32854</td>
			<td style="width:271px;">dsDNA quantitation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit assay tubes</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32856</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Qubit fluorometer</td>
			<td>Invitrogen</td>
			<td style="width:271px;">Q32866</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Ampicillin sodium salt</td>
			<td>Akron Biotechnology</td>
			<td style="width:271px;">50824296</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">MiSeq reagent kit v2 (500 cycles)</td>
			<td>Illumina</td>
			<td style="width:271px;">MS-102-2003</td>
			<td style="width:271px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">MiSeq desktop sequencer</td>
			<td>Illumina</td>
			<td style="width:271px;">http://www.illumina.com/systems/miseq.html</td>
			<td style="width:271px;">alternatively, one could sequence on Illumina HiSeq platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">FLASh software</td>
			<td>John Hopkins University - open source</td>
			<td style="width:271px;">http://ccb.jhu.edu/software/FLASH/</td>
			<td style="width:271px;">software to merge paired-end reads from next-generation sequencing data</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GATAATAATGGTTTCTTAGACGTCAGGTGGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AvrII_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">AatII_OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GACCGGACAGTTGAAATACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CGACGTACAGGACAATTTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ATTAGTACACTCCGTGAGCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTATTAGGCGTCAAGGTCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGTCCCAAGTTCAGACGTAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GAAAAGTCCCAATGAGTGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TCACTTGGTATCGAGAACGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATCACGGAAGGACTCAACG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AGATTGTTACTCCGACGGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">OP5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">TATAACAGGCTGCTGAGACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group1_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group1_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group2_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group3_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group4_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Group5_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">Group5_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">501_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">502_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">503_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">504_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:275px;">505_F</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">701_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">702_R</td>
			<td></td>
			<td style="width:271px;"></td>
			<td style="width:271px;">CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG</td>
		</tr>
	</tbody>
</table>

a protocol for functional assessment of whole-protein saturation mutagenesis libraries utilizing high-throughput sequencing

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 &#946;-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to &#946;-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.

Plasmidet kart for de fem modifiserte pBR322-plasmider inneholdende ortogonale grunningssider (pBR322_OP1 - pBR322_OP5) er vist i figur 2A. For å teste hvorvidt de ortogonale primerne er spesifikke, PCR ble utført ved bruk av hvert par med ortogonale primere enkeltvis, sammen med alle fem pBR322_OP1-5 plasmider, eller med alle plasmider minus plasmidet som samsvarer med ortogonale primerpar. Det korrekte produkt ble bare oppnådd når det samsvarende plasmidet ble inkl...

Watch this Scientific Journal Video about A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing at JoVE.com

A Protocol for Functional Assessment of Whole-Protein Saturation Mutagenesis Libraries Utilizing High-Throughput Sequencing

Vi presenterer en protokoll for funksjonell vurdering av omfattende single-site metning mutagenese biblioteker av proteiner utnytte high-throughput sekvensering. Viktigere, bruker denne tilnærmingen ortogonale primerpar å multiplekse bibliotek konstruksjon og sekvensering. Representative resultater ved hjelp av TEM-1 β-laktamase valgt på en klinisk relevant dosering av ampicillin er gitt.

En protokoll for funksjonell vurdering av Whole-Protein metning Mutagenese Biblioteker Utnytte høy gjennomstrømming sekvense

Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel ...

Research

JoVE Journal

Biology

Mutagenesis and Functional Analysis of Ion Channels Heterologously Expressed in Mammalian Cells

We will demonstrate how to study the functional effects of introducing a point mutation in an ion channel. We study G protein-gated inwardly rectifying ...

A High Throughput Screen for Biomining Cellulase Activity from Metagenomic Libraries

Cellulose, the most abundant source of organic carbon on the planet, has wide-ranging industrial applications with increasing emphasis on biofuel ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

Competitive Genomic Screens of Barcoded Yeast Libraries

By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily.  The tempo of these advances is ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Bruk av en robot for High-throughput Krystallisering av membran proteiner i Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

Biokjemiske og høy gjennomstrømning mikroskopisk vurdering av fettmasse i<em&gt; Caenorhabditis Elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay

Høy gjennomstrømming Funksjonell Screening ved hjelp av en hjemmelaget Dual-glød Luciferase Assay

We present a rapid and inexpensive high-throughput screening protocol to identify transcriptional regulators of alpha-synuclein, a gene associated with ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

Generasjon av høy kvalitet Chromatin immunoprecipitation DNA Mal for High-throughput sekvensering (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

High Throughput Microinjections of Sea Urchin Zygotes

Høy gjennomstrømning Microinjections av Sea Urchin zygoter

Microinjection into cells and embryos is a common technique that is used to study a wide range of biological processes. In this method a small amount of ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

Meget Effektiv Ligering av små RNA molekyler for mikroRNA kvantifisering av høy gjennomstrømming Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...