Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

أجريت جميع التجارب وفقا للجنة رعاية واستخدام الحيوان المؤسسي (IACUC) من المعاهد الوطنية للصحة الدليل للرعاية واستخدام حيوانات المختبر (16). ملاحظة: جميع الخطوات أدناه استخدام أنابيب الطرد المركزي انخفاض ملزم التي تم الاحتفاظ ?...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS يمكن استخدامها لفرز الخلايا العصبية وأنواع الخلايا الأخرى من أي الطازجة أو المجمدة أنسجة المخ الكبار. كما ذكر في المقدمة، القدرة على استخدام الأنسجة المجمدة تتيح استغلال الأمثل لعينات من الحيوانات التي خضعت لإجراءات سلوكية معقدة ومطولة، مثل دراسات الإدارة الذا?...

خلال التعلم والحيوانات تشكل الجمعيات بين مجموعات معقدة من المحفزات محددة للغاية. ويعتقد أن هذه المعلومات ذات الدقة العالية ليتم تشفيرها من التغييرات في أنماط محددة من الخلايا العصبية وزعت قليلة يسمى الفرق العصبية. وقد تم مؤخرا تحديد الفرق العصبية التي كتبها تحريض الجينات في وقت مبكر على الفور (IEGs) مثل فوس، قوس، وZif268 ومنتجات البروتين في الخلايا العصبية التي تم تفعيلها بقوة خلال سلوك أو التعرض جديلة. فوس، معربا عن الخلايا العصبية على وجه الخصوص وقد ثبت أن تلعب دورا السببية في سياق والسلوكيات تعلمت 1-4 جديلة محددة. وهكذا، neuroadaptations الجزيئية فريدة من نوعها ضمن هذه تنشيط الخلايا العصبية فوس، معربا هي أفضل المرشحين للالآليات العصبية التي تكود علمت جمعيات شكلت خلال اضطرابات التعلم والتعلم غير طبيعية عادية، مثل الإدمان واضطراب ما بعد الصدمة (PTSD) 5. Fluoreوقد سمحت مسرح الحادث الفرز الخلية المنشط (FACS) مؤخرا تحليل neuroadaptations الجزيئية فريدة من نوعها داخل الخلايا العصبية فوس، معربا عن. التدفق الخلوي والفرز الخلية وضعت في 1960s 6،7 لتوصيف وعزل الخلايا وفقا لخصائص ضوء تشتت ومناعي بها، وقد استخدمت لفترة طويلة في علم المناعة وأبحاث السرطان. ومع ذلك التدفق الخلوي ونظام مراقبة الأصول الميدانية يتطلب خلايا مفردة نأت التي يصعب الحصول عليها من أنسجة المخ الكبار. وقد استخدم نظام مراقبة الأصول الميدانية أول من عزل وتحليل الخضراء بروتين فلوري (GFP) -expressing الخلايا العصبية الجسم المخطط من الفئران المعدلة وراثيا التي لا تتطلب الأجسام المضادة العلامات 8،9. قمنا بتطوير القائم على الضد طريقة FACS 10 إلى عزل وتقييم التعديلات الجزيئية في فوس، معربا عن الخلايا العصبية تفعيلها من خلال المخدرات و / أو العظة في الحيوانات البرية نوع 11-15. في هذه الطريقة، وصفت الخلايا العصبية مع الأجسام المضادة ضد علامة الخلايا العصبية العامة NeuN، في حين تفعيلها بقوة الخلايا العصبيةوصفت مع الأجسام المضادة ضد فوس. على الرغم من أن طريقة الأولي لدينا يتطلب تجميع ما يصل إلى 10 فئران لكل عينة لأنسجة جديدة، سمحت التعديلات اللاحقة للبروتوكول FACS عزل فوس، معربا عن الخلايا العصبية والبلمرة الكمية سلسلة من ردود الفعل (QPCR) تحليل مناطق الدماغ منفصلة من الفئران واحد 13-15 . وعموما، تم العثور على تغيرات الجزيئية فريدة من نوعها في فوس، معربا عن الخلايا العصبية تفعيلها خلال مجموعة متنوعة من السلوكيات context- وتنشيط جديلة في أبحاث الإدمان على 12،14،15. وهناك مشكلة لوجستية كبرى مع أداء نظام مراقبة الأصول الميدانية على أنسجة جديدة هي أن يستغرق يوم كامل لفصل الأنسجة والعملية من خلال نظام مراقبة الأصول الميدانية. وبالإضافة إلى ذلك، هناك فقط حوالي أربع عينات يمكن معالجتها يوميا. وهذا يعني عادة أن منطقة الدماغ واحد فقط يمكن تقييم من كل الدماغ ومناطق الدماغ المتبقية يتعين التخلص منها. هذه هي المشكلة الرئيسية لانخفاض الإنتاجية الإجراءات السلوكية مثل الإدارة الذاتية وتري الانقراضنينغ يتطلب الجراحة وأسابيع عديدة من التدريب المكثف. وعلاوة على ذلك، والإجراءات السلوكية طويلة ومعقدة في يوم الاختبار يجعل من الصعب على أداء نظام مراقبة الأصول الميدانية في نفس اليوم. وسيكون ميزة كبيرة لتكون قادرة على تجميد العقول من الحيوانات مباشرة بعد الاختبار السلوكي، ومن ثم عزل الخلايا العصبية فوس، معربا عن من مناطق الدماغ واحدة أو أكثر في أوقات مختلفة من اختيار المحققين. هنا علينا أن نبرهن أن لدينا بروتوكول FACS يمكن استخدامها لعزل الخلايا العصبية فوس، معربا عن (وأنواع الخلايا الأخرى) من أنسجة المخ على حد سواء الطازجة والمجمدة. وكمثال على ذلك، ونحن عزل فوس، معربا عن الخلايا العصبية من المخطط الجرذان بعد حقن الميثامفيتامين الحادة ومن الفئران ساذجة بدون حقن (حالة المراقبة). ومع ذلك، هذا البروتوكول FACS يمكن استخدام أي بعد العلاج السلوكي أو الدوائي. وأشار تحليل QPCR لاحق من عينات لدينا أن التعبير الجيني من هذين النوعين من الخلايا يمكن تقييمها مع سيميكفاءة لار من الأنسجة على حد سواء الطازجة والمجمدة.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

دراسة المرونة العصبية والتعديلات الجزيئية في السلوكيات علم هو التحول من دراسة مناطق الدماغ كاملة لدراسة مجموعات محددة من الخلايا العصبية تنشيط توزيعها قليلة يسمى الفرق العصبية التي تتوسط علم الجمعيات. وقد تم مؤخرا الأمثل مضان الفرز الخلية المنشط (FACS) لأنسجة الفئران الكبار الدماغ ويسمح عزل الخلايا العصبية تفعيلها باستخدام الأجسام المضادة ضد علامة الخلايا العصبية NeuN والبروتين فوس، وهو علامة من الخلايا العصبية تفعيلها بقوة. حتى الآن، تم عزل فوس، معربا عن الخلايا العصبية وأنواع الخلايا الأخرى من أنسجة جديدة، والتي تنطوي الأيام تجهيز طويلة ويتم تقييمها بعد إجراءات طويلة ومعقدة السلوكية يسمح أعداد محدودة جدا من عينات المخ. هنا وجدنا أن غلة فوس، معربا عن الخلايا العصبية وفو مرنا من المخطط الظهرية كانت متشابهة بين تشريح الأنسجة الطازجة والأنسجة المجمدة في -80 درجة مئوية لمدة 3 - 21 أيام. وبالإضافة إلى ذلك، أكدنا على النمط الظاهريمن الخلايا إيجابية NeuN وNeuN سلبية مرتبة حسب تقييم التعبير الجيني من الخلايا العصبية (NeuN)، نجمي (GFAP)، oligodendrocytic (Oligo2) وmicrogial علامات (Iba1)، مما يدل على أن الأنسجة المجمدة يمكن أن تستخدم أيضا لنظام مراقبة الأصول الميدانية عزلة أنواع الخلايا الدبقية. عموما، فمن الممكن لجمع وتشريح وتجميد أنسجة المخ لجلسات متعددة FACS. هذا يزيد من كمية البيانات التي تم الحصول عليها من المواد الحيوانية القيمة التي غالبا ما خضعت لإجراءات سلوكية طويلة ومعقدة.

فرز الخلايا العصبية الإيجابية فوس فوس وسلبية من الطازجة والمجمدة الأنسجة الظهرية المخطط من الفئران واحدة بعد حقن الميثامفيتامين الحادة. تم استخدام بروتوكول المذكورة أعلاه لفرز الخلايا العصب...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

هنا نقدم بروتوكول الإسفار الفرز الخلية المنشط (FACS) لدراسة التعديلات الجزيئية في فوس، معربا عن الفرق العصبية من أنسجة المخ على حد سواء الطازجة والمجمدة. استخدام الأنسجة المجمدة يسمح نظام مراقبة الأصول الميدانية عزل العديد من مناطق الدماغ خلال جلسات متعددة لتحقيق الاستفادة القصوى من الموضوعات الحيوان قيمة.

مضان تنشيط الخلايا الفرز (FACS) وجين تحليل التعبير عن فوس، معربا عن الخلايا العصبية من الطازجة والمجمدة الأنسجة دماغ الفئران

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

نقرا الإسفار في الموقع التهجين في أقسام المخ طازجة

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

الأمثل تحليل الحامض النووي والتعبير الجيني من المناطق، الصغيرة تشريحيا المعرفة من الدماغ

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

وهو الإجراء الأمثل لالإسفار تنشيط عزل الخلية (نظام مراقبة الأصول الميدانية) فرز الأسلاف العصبية الاستقلال الذاتي من الجهاز التنفسي والهضمي من الفئران الجنينية

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

تسليخ مجهري ليزر لقطة من السكان المخصب من الخلايا العصبية أو الخلايا العصبية واحدة لتحليل التعبير الجيني بعد إصابات في الدماغ

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

RNA تسلسل تحليل التفاضلية التعبير الجيني في Electroporated الفرخ الجنينية الحبل الشوكي

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

التمهيدي لالمناعية على نسيج Cryosectioned دماغ الفئران: مثال تلطيخ لالدبقية الصغيرة والخلايا العصبية

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

تحليل التغييرات التعبير الجيني في الفئران الحصين بعد ديب تحفيز الدماغ الأمامي من مهادي نواة

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

باستخدام الإسفار خلية المنشط الفرز لفحص الخلية من نوع محدد التعبير الجيني في الأنسجة دماغ الفئران

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

عزل من الشعيرات الدموية الدماغية من أنسجة المخ البشري الطازج

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

الأمثل لالتقاط الليزر ميكروديسيكشن لعزل Ganglia المعوي من الأنسجة البشرية الطازجة المجمدة

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...