Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

Alle forsøg blev udført i overensstemmelse med Institutional Animal Care og brug Udvalg (IACUC) af National Institutes of Health Guide til Pleje og anvendelse af forsøgsdyr 16. Bemærk: Alle nedenstående trin brug lav-bindende centrifugeglas, som blev holdt på is, medmindre andet er angivet. 1. Forberedelse Før Tissue Collection <ol><li> Indstil centrifugen til 4 ° C. </li><li> Fire polish et sæt af tre glas Pasteur-pipetter med fa...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS kan anvendes til at sortere neuroner og andre celletyper fra enten friske eller frosne voksent hjernevæv. Som nævnt i indledningen, evnen til at bruge frosne væv giver optimal udnyttelse af prøver fra dyr, der har gennemgået komplicerede og langvarige adfærdsmæssige procedurer, såsom selv-administration og tilbagefald studier i afhængighed forskning. Disse adfærdsmæssige procedurer tager normalt 1 - 2 ud hr eller længere, og kræve, at alle dyr (10 - 20 i alt) blive testet på samme dag 13,18.</sup...

Under læring, dyr danne foreninger mellem komplekse sæt af meget specifikke stimuli. Denne høj opløsning information menes at være kodet af ændringer inden for specifikke mønstre af tyndt fordelte neuroner kaldet neuronale ensembler. Neuronale ensembler er for nylig blevet identificeret af induktion af umiddelbart tidlige gener (IEGs) såsom Fos, Arc, og Zif268 og deres proteinprodukter i neuroner, der var stærkt aktiveres under opførsel eller cue eksponering. Fos-udtrykkende neuroner i særdeleshed har vist sig at spille kausale roller i sammenhæng og cue-specifik indlært adfærd 1-4. Således unikke molekylære neuroadaptations inden for disse aktiverede Fos-udtrykkende neuroner er top kandidater til de neurale mekanismer, der koder lært sammenslutninger under normale læring og unormal læring lidelser, såsom afhængighed og post-traumatisk stress disorder (PTSD) 5. Fluorescence cellesortering (FACS) for nylig tillod analyse af unikke molekylære neuroadaptations inden Fos-udtrykkende neuroner. Flowcytometri og celle sortering blev udviklet i 1960&#39;erne 6,7 til at karakterisere og isolere celler i henhold til deres lys-spredning og immunfluorescerende egenskaber, og har længe været anvendt i immunologi og kræftforskning. Imidlertid flowcytometri og FACS kræver dissocierede enkeltceller, der er vanskelige at få fra voksent hjernevæv. FACS blev første gang brugt til at isolere og analysere Green Fluorescent Protein (GFP) udtrykkende striatale neuroner fra transgene mus, der ikke krævede antistof mærkning 8,9. Vi udviklede et antistof-baserede FACS metode 10 til isolering og vurdere molekylære ændringer i Fos-udtrykkende neuroner aktiveres af lægemiddel og / eller stikord i vildtypedyr 11-15. Ved denne fremgangsmåde er neuroner mærket med et antistof mod den generelle neuronal markør NeuN, mens stærkt aktiveret neuronerer mærket med et antistof mod Fos. Selvom vores indledende metode krævede sammenlægning af op til 10 rotter per prøve for frisk væv, efterfølgende ændringer af protokollen tillod FACS isolering af Fos-udtrykkende neuroner og kvantitativ polymerasekædereaktion (qPCR) analyse af diskrete hjerneområder fra en enkelt rotte 13-15 . Samlet set blev der unikke molekylære forandringer fundet i Fos-udtrykkende neuroner aktiveres under en række kontekstafhængige og cue-aktiverede adfærd i afhængighed forskning 12,14,15. En stor logistisk problem med at udføre FACS på frisk væv er, at det tager en hel dag til at adskille vævet og processen ved FACS. Desuden kan kun omkring fire prøver behandles per dag. Dette betyder sædvanligvis, at kun én hjerneområde kan vurderes fra hver hjerne og de resterende hjerneområder skal kasseres. Dette er et stort problem for lav gennemløb adfærdsmæssige procedurer såsom selvadministration og udslettelse training, der kræver operation og mange ugers intensiv træning. Endvidere lange og komplicerede adfærdsmæssige procedurer på testdagen gør det vanskeligt at udføre FACS på samme dag. Det ville være en betydelig fordel at kunne indefryse hjerner fra dyrene umiddelbart efter adfærdsmæssige test, og derefter isolere Fos-udtrykkende neuroner fra en eller flere områder i hjernen på forskellige tidspunkter af efterforskerne &#39;valg. Her demonstrerer vi, at vores FACS protokol kan bruges til at isolere Fos-udtrykkende neuroner (og andre celletyper) fra både friske og frosne hjernevæv. Som et eksempel, vi isolerede Fos-udtrykkende neuroner fra rotte-striatum efter akut metamfetamin injektioner og fra naive rotter uden injektioner (kontrol betingelse). Dog kan denne FACS protokol anvendes efter enhver adfærdsmæssig eller farmakologisk behandling. Efterfølgende qPCR-analyse af vores prøver viste, at genekspression fra disse celletyper kunne vurderes med similar effektivitet fra både fersk og frossen væv.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

Studiet af neuroplasticitet og molekylære ændringer i lærde adfærd skifter fra undersøgelsen af ​​hele områder af hjernen til studiet af specifikke sæt af tyndt fordelte aktiverede neuroner kaldet neuronale ensembler, der medierer lært foreninger. Fluorescence Activated Cell Sorting (FACS) er for nylig blevet optimeret til voksne rotter hjernevæv og tilladt isolation af aktiverede neuroner under anvendelse af antistoffer mod den neuronale markør NeuN og Fos-protein, en markør for stærkt aktiverede neuroner. Indtil nu, blev Fos-udtrykkende neuroner og andre celletyper isoleret fra frisk væv, hvilket medførte lange behandlingstider dage og tilladt meget begrænset antal hjerne prøver, der skal vurderes efter langvarige og komplicerede adfærdsmæssige procedurer. Her fandt vi, at udbyttet af Fos-udtrykkende neuroner og Fos mRNA fra dorsale striatum var ens mellem frisk dissekeret væv og væv frosset ved -80 ºC i 3 - 21 dage. Desuden bekræftede vi fænotypenDe NeuN-positive og NeuN-negative sorterede celler ved at vurdere genekspression af neuronal (NeuN), astrocytiske (GFAP), oligodendrocytic (Oligo2) og microgial (Iba1) markører, hvilket indikerer, at frosne væv også kan anvendes til FACS isolering af gliale celletyper. Samlet set er det muligt at indsamle, dissekere og fryse hjernevæv for flere FACS sessioner. Dette maksimerer mængden af ​​data fra værdifulde dyr emner, der ofte har gennemgået lange og komplekse adfærdsmæssige procedurer.

Sortering Fos-positive og Fos-negative neuroner fra fersk og frosset dorsale striatum væv fra enkelte rotter efter akut metamfetamin injektioner. Den ovenfor beskrevne protokol blev anvendt til at sortere Fos-positive og Fos-negative neuroner fra en enkelt rotte dorsal striatum 90 min efter en intraperitoneal injektion af methamfetamin (5 mg / kg). Naive rotter i deres bure blev anvendt som kontroller. Dorsal striatum væv bl...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Her præsenterer vi en Fluorescence Activated Cell Sorting (FACS) protokol til at studere molekylære ændringer i Fos-udtrykkende neuronale ensembler fra både fersk og frossen hjernevæv. Brugen af ​​frosne væv tillader FACS isolering af mange områder i hjernen over flere sessioner for at maksimere brugen af ​​værdifulde dyr fag.

Fluorescensaktiveret cellesortering (FACS) og Gene Expression Analyse af Fos-udtrykkende neuroner fra Fresh and Frozen Rat Brain Tissue

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Optimeret Analyse af DNA methylering og genekspression fra små, anatomisk definerede områder af hjernen

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

En optimeret Fremgangsmåde til fluorescens-aktiveret cellesortering (FACS) Isolering af autonome Neurale stamceller fra indre organer af føtale Mus

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Laser Capture mikrodissektion af beriget populationer af neuroner eller enkelte neuroner til genekspression analyse efter traumatisk hjerneskade

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

RNA-Seq analyse af differentiel genekspression i elektroporerede Chick embryonale Spinal Cord

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

Primer til Immunhistokemi på Cryosectioned Rat Brain Tissue: Eksempel farvning for Mikroglia og Neuroner

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Analyse af genekspression Ændringer i rottehippocampus Efter Deep Brain Stimulation af den forreste thalamiske Nucleus

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Isolering af cerebrale kapillærer fra frisk menneskelige hjernevæv

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

Optimering af Laser-Capture Microdissection til isolering af entero ganglier fra frisk frosset menneskeligt væv

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...