Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

Alle Experimente wurden in Übereinstimmung mit der Institutional Animal Care und Use Committee (IACUC) der National Institutes of Health Guide für die Pflege und Verwendung von Labortieren 16 durchgeführt. Hinweis: Alle Schritte unter Verwendung schwach bindende Zentrifugenröhrchen, die auf Eis gehalten wurden, sofern nicht anders angegeben. 1. Vorbereitung vor dem Gewebeentnahme <ol><li> Stellen Sie die Zentrifuge bis 4 o C. </li><li>...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS verwendet werden Neuronen zu sortieren und andere Zelltypen entweder frisch oder gefroren adult Hirngewebe. Wie in der Einleitung erwähnt, ermöglicht die Fähigkeit, gefrorene Gewebe zu verwenden, eine optimale Nutzung von Proben von Tieren, die komplexe und langwierige Verhaltensverfahren, wie zum Beispiel Selbstverwaltung und Rückfall-Studien in der Suchtforschung unterzogen wurden. Diese Verhaltensverfahren dauert in der Regel 1 bis 2 Stunden oder länger, und verlangen , dass alle Tiere (10 - 20 insgesamt) a...

Während des Lernens bilden Tiere Assoziationen zwischen komplexen Sätzen von hochspezifische Reize. Diese hochauflösende Informationen wird angenommen, dass durch Veränderungen in spezifischen Mustern von spärlich verteilten Neuronen genannt neuronalen Ensembles codiert werden. Neuronale Ensembles durch die Induktion von unmittelbar frühen Gene (IEGs) wie Fos, Arc und Zif268 und ihre Proteinprodukte in Neuronen identifiziert , die waren stark aktiviert während Verhalten oder Cue - Exposition vor kurzem wurde. Fos-exprimierenden Neuronen insbesondere gezeigt wurden 1-4 kausalen Rollen in Zusammenhang und Cue spezifische erlernten Verhaltensweisen zu spielen. Somit einzigartige molekulare neuroadaptations innerhalb dieser aktivierten Fos-exprimierenden Neuronen sind Top - Kandidaten für die neuronalen Mechanismen, die die Verbände , während des normalen Lernen und abnormal Lernstörungen, wie Sucht und posttraumatische Belastungsstörung (PTSD) 5 gelernt kodieren. fluorescence Activated Cell Sorting (FACS) wurde Analyse von einzigartigen molekularen neuroadaptations in Fos-exprimierenden Neuronen vor kurzem erlaubt. Durchflusszytometrie und Zellsortierung wurden in den 1960er Jahren entwickelt 6,7 zu charakterisieren und zu isolieren Zellen entsprechend ihrer Lichtstreuung und Immunfluoreszenz - Eigenschaften und sind seit langem in der Immunologie und Krebsforschung eingesetzt. fließen jedoch Zytometrie und FACS erfordert dissoziierten einzelne Zellen, die aus adulten Hirngewebe zu erhalten, sind schwierig. FACS wurde zuerst verwendet , Green Fluorescent Protein (GFP) exprimierenden striatalen Neuronen aus transgenen Mäusen zu isolieren und zu analysieren , die nicht mehr als 8,9 Antikörpermarkierung erforderlich war. Wir entwickelten einen Antikörper-basierten FACS Methode 10 zu isolieren und molekularen Veränderungen bewerten in Neuronen , die durch Drogen aktiviert Fos-exprimierenden und / oder Hinweise in Wildtyp - Tiere 15.11. In diesem Verfahren werden die Neuronen mit einem Antikörper gegen den neuronalen Marker NeuN allgemeinen bezeichnet, während Neuronen stark aktiviertenmit einem Antikörper gegen Fos markiert. Obwohl unsere ursprüngliche Methode Bündelung der erforderlichen bis zu 10 Ratten pro Probe für frisches Gewebe, spätere Änderungen des Protokolls erlaubt FACS Isolierung von Fos-exprimierenden Neuronen und quantitative Polymerase - Kettenreaktion (qPCR) Analyse einzelner Hirnareale von einer einzelnen Ratte 13-15 . Insgesamt wurden einzigartige molekulare Veränderungen gefunden in Neuronen während einer Vielzahl von kontext- und Cue-aktivierte Verhalten in der Suchtforschung 12,14,15 aktiviert Fos-exprimierenden. Eine große logistische Problem mit der Durchführung FACS auf frischem Gewebe ist, dass es einen ganzen Tag dauert das Gewebe und Verfahren durch FACS zu distanzieren. Darüber hinaus können nur etwa vier Proben pro Tag verarbeitet werden. Dies bedeutet in der Regel, dass nur ein Bereich des Gehirns von jedem Gehirn beurteilt werden kann, und die verbleibenden Gehirnbereiche haben zu verwerfen. Dies ist ein großes Problem für geringen Durchsatz Verhaltens Verfahren wie Selbstverwaltung und vom Aussterben Training, die Chirurgie und viele Wochen intensives Training erfordert. Darüber hinaus macht lange und komplizierte Verhaltensverfahren auf Testtag schwierig es FACS am selben Tag durchzuführen. Es wäre ein erheblicher Vorteil sein, um die Gehirne von den Tieren nach der Verhaltenstests sofort einzufrieren und dann isolieren Fos-exprimierenden Neuronen aus einem oder mehreren Bereichen des Gehirns zu unterschiedlichen Zeiten des Wählens der Ermittler. Hier zeigen wir, dass unser FACS-Protokoll verwendet werden können, Fos-exprimierenden Neuronen (und andere Zelltypen) zu isolieren sowohl von frischen und gefrorenen Gehirngewebe. Als Beispiel isolierten wir Neuronen aus Rattenstriatum nach akuter Methamphetamin Injektionen und von naiven Ratten ohne Injektionen (Steuerzustand) Fos-exprimierenden. Allerdings kann dieses FACS Protokoll nach jeder Verhaltens- oder pharmakologische Behandlung verwendet werden. Die anschließende qPCR Analyse unserer Proben zeigte, dass die Genexpression von diesen Zelltypen mit Simi bewertet werden konntelar Effizienz von frischem und gefrorenem Gewebe.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

Die Studie der Neuroplastizität und molekularen Veränderungen in erlernten Verhaltensweisen aus der Studie von ganzen Hirnregionen zur Untersuchung spezifischer Sätze von spärlich verteilten aktivierten Neuronen Schalt neuronalen Ensembles genannt, die Verbände vermitteln gelernt. Fluorescence Activated Cell Sorting (FACS) wurde vor kurzem für erwachsene Rattenhirngewebe und erlaubt die Isolierung von aktivierten Neuronen optimiert Antikörpern gegen den neuronalen Marker NeuN und Fos Protein, ein Marker der stark aktivierten Neuronen verwenden. Bisher Fos-exprimierenden Neuronen und anderen Zelltypen wurden aus frischem Gewebe isoliert, die lange Bearbeitungs Tage und erlaubt sehr begrenzte Anzahl von Gehirnproben brachte nach langwierigen und komplexen Verhaltensverfahren beurteilt werden. Hier fanden wir , dass die Renditen von Fos-exprimierenden Neuronen und Fos mRNA aus dorsalen Striatum ähnlich waren zwischen frisch sezierten Gewebe und Gewebe bei -80 ° C eingefroren 3 - 21 Tage. Zusätzlich bestätigten wir den Phänotypder NeuN-positive und NeuN-negativ sortierten Zellen durch die Bewertung der Genexpression von neuronalen (NeuN), astrozytären (GFAP), oligodendrocytic (Oligo2) und microgial (Iba1) Marker, die das gefrorene Gewebe für FACS Isolierung kann auch verwendet werden , von Glia-Zelltypen. Insgesamt ist es möglich, zu sammeln, zu sezieren und Hirngewebe für mehrere FACS Sitzungen einzufrieren. Dies maximiert die Menge von Daten von wertvollen tierischen Subjekten erhalten, die oft schon lange und komplexe Verhaltensverfahren unterzogen.

Sortierung Fos-positive und Fos-negativen Neuronen aus frischen und gefrorenen dorsalen Striatum Gewebe aus einzelnen Ratten nach akuter Methamphetamin Injektionen. Die oben beschriebenen Protokoll wurde verwendet, Fos-positiven und Fos-negativer Neuronen von einer einzigen Ratte dorsalen Striatum 90 Minuten nach einer intraperitonealen Injektion von Methamphetamin zu sortieren (5 mg / kg). Naïve Ratten in ihre Käfige wurden...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Hier präsentieren wir eine Fluorescence Activated Cell Sorting (FACS) Protokoll zu untersuchen molekulare Veränderungen in Fos-exprimierenden neuronalen Ensembles aus frischen und gefrorenen Hirngewebe. Die Verwendung von gefrorenem Gewebe ermöglicht FACS Isolierung von vielen Bereichen des Gehirns über mehrere Sitzungen hinweg die Verwendung von wertvollen tierischen Patienten zu maximieren.

Fluorescence Activated Cell Sorting (FACS) und Genexpressionsanalyse von Fos-exprimierenden Neurone von Frische und Gefrorene Rattenhirngewebe

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Doppel-Fluoreszenz- In situ Hybridisierung in Fresh Hirnschnitten

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Forschung

Neurowissenschaften

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Optimierte Analyse von DNA-Methylierung und Genexpression von Klein, Anatomisch-definierte Bereiche des Gehirns

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

Eine optimierte Methode für Fluorescence-Activated Cell Sorting (FACS) Isolierung von Autonomic neuralen Vorläuferzellen aus inneren Organen des Fötus Mäuse

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Laser Capture Mikrodissektion von Angereichert Populationen von Neuronen oder Single Neurons zur Genexpressionsanalyse Nach Traumatic Brain Injury

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

RNA-Seq Analyse der differentiellen Genexpression in elektroporiertem Küken Embryonale Spinal Cord

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

Primer für die Immunhistochemie auf gefriergeschnitten Rat Brain Tissue: Beispiel Färbung für Mikroglia und Neuronen

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Die Analyse der Genexpression Veränderungen im Hippocampus Ratte nach Tiefenhirnstimulation des Anterior Thalamuskern

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Isolierung der zerebralen Kapillaren aus frischem menschlichen Hirngewebe

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

Optimierung der Capture-Laser Mikrodissektion für die Isolierung der enterischen Ganglien aus menschlichem Gewebe Tiefkühlfrische

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...