Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

כל הניסויים בוצעו בהתאם ועדת טיפול בבעלי חיים מוסדיים השתמש (IACUC) של ה- National Institutes of Health מדריך לטיפול ושימוש בחיות מעבדה 16. הערה: כל השלבים הבאים צינורות צנטריפוגה שימוש מחייב נמוכים כי הוחזקו על קרח אלא אם צוין אחר. <p class="jove...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

ניתן להשתמש FACS למיין נוירונים סוגי תאים אחרים מרקמות המוח המבוגר טרי או קפוא. כפי שהוזכר במבוא, את היכולת להשתמש רקמה קפוא מאפשרת ניצול אופטימלי של דגימות מבעלי החיים שעברו הליכי התנהגותי מורכבים וממושך, כגון לימודי מנהל עצמי ו להרע במחקר התמכרות. נהלי התנהגות אלה בד...

במהלך למידה, חיות להתאגד בין מכלולי גירויים מאוד ספציפיים. מידע ברזולוציה גבוהה זה הוא חשב להיות מקודד על ידי שינויים בתוך דפוסים מסוימים של נוירונים בדלילות שנקראים רכבים עצביים. רכבים עצביים זוהו לאחרונה על ידי האינדוקציה של גנים מוקדם מייד (IEGs) כגון Fos, Arc, ואת Zif268 ומוצרי החלבון שלהם בנוירונים אשר הופעלו בתוקף במהלך התנהגות או חשיפת קיו. Fos-להביע עצב בפרט הוכח לשחק תפקידים סיבתי בהקשר ו קיו ספציפי למדו התנהגויות 1-4. לפיכך, neuroadaptations המולקולרי הייחודי בתוך המופעל אלה נוירונים Fos להביע הם מועמדים מובילים עבור המנגנונים העצביים מקודדים למדו עמותות נוצרו במהלך למידה רגילה ולמידה נורמלית הפרעות, כגון התמכרות והפרעת דחק פוסט-טראומטית (PTSD) 5. FluoreCell Scence המיון המופעל (FACS) אפשר ניתוח לאחרונה neuroadaptations המולקולרי הייחודי בתוך הנוירונים להביע Fos. Cytometry זרימה מיון תאים שפותחו בשנות ה -1960 6,7 לאפיין ולבודד תאים לפי מאפייני פיזור האור ואת immunofluorescent שלהם, ואת כבר זמן רב בשימוש באימונולוגיה וחקר הסרטן. עם זאת cytometry זרימת FACS דורש תאים בודדים ניתקים שקשה להשיג מרקמות מוח מבוגרות. FACS שימש לראשונה לבודד ולנתח חלבון פלואורסצנטי ירוק (GFP) -expressing נוירונים striatal מעכברים מהונדס כי לא דורשים תיוג נוגדן 8,9. פתחנו שיטת FACS מבוסס נוגדנים 10 לבודד ולהעריך שינויים מולקולריים Fos-להביע עצב מופעל על ידי סמים ו / או רמזים בחי סוג בר 11-15. בשיטה זו, נוירונים מסומנים עם נוגדן כנגד הסמן עצבי הכללי NeuN, בעוד מופעל בחום נוירוניםמסומנים עם נוגדן כנגד Fos. אמנם השיטה הראשונית שלנו נדרשת איגום של עד 10 חולדות לדגימה עבור רקמה טריה, שינויים מאוחרים יותר של הפרוטוקול מותר בידוד FACS של נוירונים Fos-הבעת תגובת שרשרת פולימראז כמותיים (qPCR) ניתוח של אזורים במוח הבדידים של חולדה אחת 13-15 . בסך הכל, שינויים מולקולריים ייחודיים נמצאו Fos-להביע עצב המופעל במהלך מגוון של התנהגויות להיקשר ו קיו המופעל במחקר התמכרות 12,14,15. בעיה לוגיסטית גדולה עם ביצוע FACS על רקמה טריה היא שזה לוקח יום שלם כדי לנתק את הרקמה ותהליך ידי FACS. בנוסף, רק כארבע דגימות יכולות להיות מעובד ליום. בדרך כלל זה אומר כי רק באזור מוח אחד ניתן להעריך מכל מוח ואת אזורי המוח הנותרים צריכים להיות מושלכים. זוהי אחת בעיות עיקריות עבור נהלי התנהגות תפוקה נמוכה כגון מנהל עצמי ואת trai ההכחדהנינג הדורש ניתוח ושבועות רבים של אימונים אינטנסיביים. יתר על כן, ארוכים ומורכבים נהלי התנהגות ביום בדיקה מקשה לבצע FACS באותו היום. זה יהיה יתרון משמעותי על מנת להיות מסוגל להקפיא את המוח מן הבהמה מיד לאחר בדיקות התנהגותיות, ולאחר מכן לבודד נוירונים Fos להביע מאזורים במוח אחד או יותר בזמנים שונים לפי בחירת החוקרים. כאן אנו מראים כי פרוטוקול FACS שלנו יכול לשמש כדי לבודד נוירונים Fos להביע (סוגי תאים אחרים) משתי רקמת מוח טריה וקפואה. כדוגמא, אנחנו מבודדים Fos-להביע עצב מן בסטריאטום עכברוש לאחר זריקות מתאמפטמין אקוטיות של חולדות נאיביות ללא זריקות (מצב מלא). עם זאת, פרוטוקול FACS זה יכול לשמש לאחר כל טיפול התנהגותי או תרופתי. ניתוח qPCR העוקבת של דגימות שלנו עולה כי ביטוי גנים סוגי תאים אלה ניתן להעריך עם סימייעילות Lar משתי רקמות טריות וקפואות.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

המחקר של פלסטיות עצבית ושינויים מולקולריים התנהגויות למדו עובר מהמחקר של אזורים במוח כולו ללימוד קבוצות הספציפיות של נוירונים מופעלים בדלילות שנקראים רכבים עצביים אשר מתווכות למדו עמותות. תא קרינת מיון מופעל (FACS) כבר מותאם לאחרונה עבור רקמת מוח עכברוש מבוגר ואפשר בידוד של נוירונים מופעלים באמצעות נוגדנים נגד הסמן העצבי NeuN ו Fos חלבון, סמן של נוירונים הופעל בחום. עד עכשיו, פוס-להביע עצב סוגי תאים אחרים נותקו מן הרקמה טריה, שהיה כרוכות ימי עיבוד ארוכים ואפשרו מספרים מצומצמים מאוד של דגימות המוח יוערכו לאחר נהלי התנהגות ממושכים ומורכבים. כאן מצאנו כי התשואות של Fos-להביע עצב ו Fos mRNA מ בסטריאטום הגבי היו דומות בין רקמות טרי גזור ורקמות קפוא ב -80 ºC עבור 3 - 21 ימים. בנוסף, אישרנו את הפנוטיפשל NeuN-חיובי תאים ממוינים NeuN שליליים על ידי סמני ביטוי גנים בהערכת סעיף עצבי (NeuN), astrocytic (GFAP), oligodendrocytic (Oligo2) ו microgial (Iba1), אשר מציין כי רקמה קפוא יכולה לשמש גם לבידוד FACS של סוגי תאי גליה. בסך הכל, אפשר לאסוף, לנתח ולהקפיא רקמת מוח הפעלות FACS המרובה. זה ממקסם את כמות נתונים המתקבלים בנושאי בעלי חיים יקרים, כי לעתים קרובות עברו נהלי התנהגות ארוכים ומורכבים.

מיון נוירונים Fos-חיובי Fos-שלילי מרקמות בסטריאטום הגבה טריות וקפואות מן החולדות יחידות לאחר זריקות מתאמפטמין חריפות. הפרוטוקול המתואר לעיל היה רגיל לסוג Fos-חיובי Fos-שלילי נוירונים מתוך 90 דקות בס?...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

כאן אנו מציגים מיון תא הופעל קרינה (FACS) פרוטוקול ללמוד שינויים מולקולריים Fos להביע רכבים עצביים משתי רקמת מוח טריה וקפואה. שימוש רקמה קפוא מאפשר בידוד FACS של אזורי מוח רבים על פני פגישות מרובות כדי למקסם את השימוש בנושאי בעלי חיים בעלי ערך.

רקמות קרינה הופעלו מיון תאים (FACS) וניתוח ביטוי גנים של נוירונים Fos להביע מ טרי קפוא מוח החולדה

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

פעמיים פלואורסצנטי באתרו הכלאה בסעיפים המוח טריים

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

ניתוח אופטימיזציה של מתילציה דנ&quot;א ביטוי גנים מ, אזורים קטנים אנטומית מוגדרים של המוח

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

נוהל אופטימליים עבור Fluorescence המופעל בידוד מיון (FACS) תא של אבות עצביות האוטונומית מאיברים בטן של עכברים עוברית

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Microdissection לכידת ליזר אוכלוסיות מועשרות של הנוירונים או נוירונים יחידים לניתוח ביטוי גנים לאחר פגיעה מוחית טראומטית

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

RNA-Seq ניתוח של ביטוי הגנים בדיפרנציאל חוט השדרה Electroporated אפרוח עוברי

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

פריימר לאימונוהיסטוכימיה על רקמות Cryosectioned מוח חולדה: דוגמא להכתמת Microglia ונוירונים

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

ניתוח שינויי ביטוי הגנים בהיפוקמפוס העכברוש לאחר Deep Brain Stimulation של Anterior התלמוס הגרעין

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

ביטוי גנים מסוג התא ספציפי באמצעות סלולארי קרינה המופעל מיון לבדיקת רקמות במוח החולדה

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

בידוד של נימים מוחי מרקמות המוח האנושי טריים

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

אופטימיזציה של לכידת לייזר Microdissection עבור בידודו של הגרעינים המעית מרקמות אנושיות מוקפאות

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...