Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

모든 실험은 실험 동물 (16)의 관리 및 사용을위한 건강 가이드의 국립 연구소의 기관 동물 관리 및 사용위원회 (IACUC)에 따라 수행 하였다. 참고 : 달리 명시되지 않는 한 얼음에 보관 된 사용 낮은 결합 원심 분리기 튜브 아래의 모든 단계. 조직 컬렉션 전에 1. 준비 <ol><li> 4 O C.에 원심 분리기를 설정 </li><li> 화재 폴란드어 감소 약 1.3의 ?...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS는 어느 신선하거나 냉동 성인 뇌 조직의 신경 세포 및 다른 세포 유형을 정렬하기 위해 사용될 수있다. 서론에서 언급 한 바와 같이, 냉동 조직을 사용하는 능력은 중독 연구에 자기 관리 및 재발 연구 등 복잡하고 연장 된 행동 절차를받은 동물에서 샘플의 최적 활용을 할 수 있습니다. 2 시간 이상, 모든 동물이 필요합니다 - 이러한 행동 절차는 보통 1 소요됩니다 - 같은 날 13,18 테스?...

학습하는 동안, 동물은 매우 구체적인 자극의 복잡한 세트 사이의 연결을 형성한다. 이것은 고해상도 정보 신경 앙상블이라 띄엄 띄엄 분산 된 뉴런의 특정 패턴 내의 변화에​​ 의해 인코딩 될 것으로 생각된다. 신경 앙상블은 최근 강하게 행동이나 큐 노출시 활성화 된 예에 Fos, 아크 및 Zif268 및 신경 세포에서의 단백질 제품으로 즉시 초기 유전자 (IEGs)의 유도에 의해 확인되었다. 특히 상황과 큐 - 특정 배운 행동 1-4에 인과 역할을하는 것으로 나타났다 신경을 FOS는 발현. 따라서, 이러한 활성화에 Fos 발현하는 신경 세포 내에서 고유 분자 neuroadaptations은 중독과 외상 후 스트레스 장애 (PTSD) 5 정상적으로 학습과 이상 학습 장애 동안 형성된 협회를 알게 인코딩 신경 메커니즘에 대한 상위 후보입니다. Fluore에서 scence 활성화 된 셀 정렬 (FACS)는 최근에 Fos 발현하는 신경 세포 내에서 고유 분자 neuroadaptations의 분석을 허용했다. 유세포 셀은 광 산란 특성에 따라 면역 세포를 특성화하고 분리 1960 -6,7- 개발되었다 정렬 및 긴 면역학 및 암 연구에 사용되었다. 그러나 유동 세포 계측법 및 FACS는 성인 뇌 조직에서 얻기 어려운 해리 하나의 세포가 필요합니다. FACS는 제 8,9 항체 표지가 필요하지 않은 트랜스 제닉 마우스로부터의 선조체 뉴런 발현 분리하고 (GFP)에 녹색 형광 단백질을 분석하는데 사용 하였다. 우리는 분리 및 야생형 동물 11-15에서 약물 및 / 또는 단서에 의해 활성화 된 뉴런에 Fos가 발현 분자 변화를 평가하는 항체 기반 FACS 방법 (10)을 개발했다. 강하게 신경 세포를 활성화하는 동안이 방법에서는, 신경 세포는 일반적으로 신경 세포 마커 NeuN에 대한 항체로 표시되어 있습니다에 Fos에 대한 항체로 표시되어 있습니다. 우리의 초기 방법은 신선한 조직 샘플 당 최대 10 쥐의 풀링을 요구하지만, 프로토콜의 이후의 변경은 단일 쥐 13-15에서 분리 된 뇌 영역에 Fos 발현 뉴런과 정량적 중합 효소 연쇄 반응을 (qPCR에) 분석 FACS 분리 허용 . 전반적으로, 독특한 분자 변경은 중독 연구 12,14,15의적인 상황과 큐 활성화 행동의 다양한 동안 활성화 뉴런에 Fos가 발현에서 발견되었다. 신선한 조직에 FACS를 수행와 주요 물류 문제는 FACS에 의해 조직 및 프로세스를 해리 하나 하루 종일 걸리는 것입니다. 또한, 약 4 개의 샘플은 하루에 처리 될 수있다. 이것은 일반적으로 하나의 뇌 영역마다 뇌에서 평가 될 수 있고, 나머지 뇌 영역을 폐기해야하는 것을 의미한다. 이것은 자기 관리 및 멸종 TRAI 낮은 처리량 행동 절차에 대한 주요 문제수술과 집중적 인 훈련의 많은 주를 필요로 닝. 또, 시험 당일에 길고 복잡한 행동 절차 어려운 당일 FACS를 수행 할 수있다. 이것은 중요한 이점을 즉시 행동 시험 후 동물로부터 뇌를 고정 할 수있을하고 조사자 선택한 다른 시간에 하나 이상의 뇌 영역 FOS를 발현하는 신경 세포를 분리한다. 여기서 우리는 FACS 프로토콜 신선한 냉동 모두 뇌 조직 FOS를 발현하는 신경 세포 (및 다른 유형의 세포)를 분리하기 위해 사용될 수 있음을 보여준다. 예를 들어, 우리는 급성 필로폰 주사 후 주사 (제어 조건)없이 순진한 쥐에서 쥐 선조체의 신경 세포에 Fos가 발현입니다. 그러나이 프로토콜은 FACS 어떤 행동 또는 약물 치료 다음 사용될 수있다. 우리의 샘플의 후속의 qPCR 분석은 이들 세포 타입에서 유전자의 발현이 미으로 평가 될 수 있다고 지적신선한 냉동 모두 조직에서 LAR 효율.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

신경 가소성 및 학습 행동의 분자 변화의 연구는 협회를 알게을 중재 신경 앙상블라고 띄엄 띄엄 분산 활성화 된 뉴런의 특정 세트의 연구에 전체 뇌 영역의 연구로 전환된다. (FACS)을 정렬 형광 활성 세포는 최근 성인 쥐의 뇌 조직에 최적화 신경 마커 NeuN과에 Fos 단백질, 강력하게 활성화 된 신경 세포의 마커에 대한 항체를 사용하여 활성화 된 뉴런의 분리를 허용하고있다. 지금까지에 Fos 발현하는 신경 세포와 다른 세포 유형은 긴 처리 일 길고 복잡한 행동 절차 후 평가하기 위해 뇌 샘플을 허용 매우 제한된 숫자를 수반 신선한 조직에서 분리 하였다. 이십일일 - 여기에서 우리는 등쪽 선조체의 신경과에 Fos mRNA의 별점이 발현의 수익률이 3 -80 ºC에서 동결 갓 해부 조직과 조직 사이의 유사한 것으로 나타났다. 또, 표현형 확인냉동 조직은 또한의 FACS 분리에 사용할 수 있음을 나타냅니다 신경의 평가 유전자 발현 (NeuN), 성상 세포 (GFAP), oligodendrocytic (Oligo2) 및 microgial (Iba1) 마커에 의한 NeuN 양성 및 NeuN 음성 분류 세포의 아교 세포 유형. 전반적으로, 이는 수집 해부 복수 FACS 세션을위한 뇌 조직을 고정 할 수있다. 이것은 종종 길고 복잡한 행동 절차를 거친 유용한 동물 대상에서 획득 된 데이터의 양을 최대화한다.

급성 필로폰 주사 후 한 쥐에서 신선한 냉동 등쪽 선조체 조직 FOS를 양성과에 Fos 음이 신경 세포를 정렬. 위에서 설명한 프로토콜은 필로폰 (5 ㎎ / ㎏)의 복강 내 주사 후 한 쥐의 등쪽 선조체 90 분 FOS를 양성과에 Fos 음이 신경 세포를 정렬하기 위해 사용되었다. 자신의 홈 케이지에서 순진한 쥐를 대조군으로 사용 하였다. 지?...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

여기에서 우리는 신선한 냉동 모두 뇌 조직에서 신경 앙상블 별점이 발현 분자 변화를 연구하는 형광 활성화 된 셀 정렬 (FACS) 프로토콜을 제안한다. 동결 조직의 사용은 유용한 동물 피험자의 사용을 최대화하기 위해 다수의 세션을 통해 많은 뇌 영역의 FACS 분리 할 수​​있다.

형광 활성화 된 셀 정렬 (FACS)와 신선한 및 냉동 쥐 뇌 조직 FOS를 발현하는 신경 세포의 유전자 발현 분석

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

더블 형광 현장에서</em신선한 두뇌 섹션> 하이브 리다이 제이션

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

연구

신경과학

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

뇌의 작은, 해부학적인 몸의 구조 정의 분야의 DNA Methylation과 유전자 발현의 최적화 분석

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

태아 쥐의 내장 장기에서 자율 신경 Progenitors의 형광 - 활성 셀 정렬 (FACS) 절연을위한 최적화된 절차

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

외상성 뇌 손상 후 뉴런 또는 유전자 발현 분석을위한 단일 뉴런의 강화 인구의 레이저 캡처 Microdissection

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

electroporation하여 병아리 배아 척수에서 차동 유전자 발현의 RNA-SEQ 분석

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

미세 아교 세포와 신경 세포에 대한 예 염색 : 저온 절단 된 쥐의 뇌 조직에서 면역 조직 화학에 대한 입문서

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

전방 시상 핵의 깊은 뇌 자극 후 쥐 해마의 유전자 발현 변화 분석

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

쥐 뇌 조직 검사 정렬 형광 활성 셀을 사용하여 셀 타입 별 유전자 발현

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

신선한 인간의 뇌 조직에서 뇌 모세 혈관의 절연

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

신선한 냉동 인간 조직에서 장의 중추의 격리에 대 한 레이저 캡처 서의 최적화

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...