Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

Alle forsøkene ble utført i henhold til Institutional Animal Care og bruk Committee (IACUC) av National Institutes of Health Guide for omsorg og bruk av forsøksdyr 16. Merk: Alle trinnene under bruk lav-bindende sentrifugerør som ble holdt på is med mindre annet er spesifisert. 1. Forberedelser Før Tissue Collection <ol><li> Sett sentrifugen til 4 o C. </li><li> Brann polish et sett med tre glass Pasteur pipetter med avtagende diamet...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS kan brukes til å sortere nevroner og andre celletyper fra enten friske eller frosne voksen hjernevevet. Som nevnt i innledningen, muligheten til å bruke frosne vev tillater optimal utnyttelse av prøver fra dyr som har gjennomgått kompliserte og langvarige atferdsmessige prosedyrer, slik som selvadministrering og tilbakefalls studier i avhengighet forskning. Disse atferdsmessige fremgangsmåtene tar vanligvis 1 - 2 timer eller lenger, og krever at alle dyrene (10 - 20 totalt) bli testet på den samme dag 13...

Under læring, dyr danne assosiasjoner mellom komplekse sett av svært spesifikke stimuli. Dette høyoppløselige informasjon er tenkt å bli kodet av endringer innenfor bestemte mønstre av tynt fordelt nevroner kalles nevrale ensembler. Neuronal ensembler har nylig blitt identifisert ved induksjon av umiddelbart tidlige gener (IEGs) som Fos, Arc, og Zif268 og deres proteinprodukter i neuronene som var sterkt aktivert i løpet av oppførsel eller cue eksponering. Fos-uttrykke nevroner i særdeleshet har vist seg å spille kausale roller i sammenheng og cue-spesifikke lært atferd 1-4. Dermed unike molekylære neuroadaptations innenfor disse aktiverte Fos-uttrykke nevroner er topp kandidater til de nevrale mekanismene som koder lært foreninger dannet under normale læring og unormal læring lidelser, for eksempel avhengighet og posttraumatisk stresslidelse (PTSD) 5. Fluorescence Aktivert Cell Sorting (FACS) har nylig tillatt analyse av unike molekylære neuroadaptations innenfor Fos-uttrykke nevroner. Flowcytometri og cellesortering ble utviklet i 1960-årene 6,7 for å karakterisere og isolere celler i henhold til deres lys-spredning og immuno-egenskaper, og har lenge vært brukt i immunologi og kreftundersøkelser. Imidlertid flowcytometri og FACS krever dissosierte enkeltceller som er vanskelig å få tak i fra voksen hjernevevet. FACS ble først brukt til å isolere og analysere grønt fluorescerende protein (GFP) -expressing striatale nevroner fra transgene mus som ikke krever antistoff merking 8,9. Vi utviklet et antistoff-basert FACS metode 10 for å isolere og vurdere molekylære endringer i Fos-uttrykke nevroner aktiveres av narkotika og / eller signaler i villtype dyr 11-15. I denne metoden, blir neuroner merket med et antistoff mot det generelle neuronal markør Neun, mens sterkt aktivert neuronerer merket med et antistoff mot Fos. Selv om vår første metode kreves sammenslåing av opp til 10 rotter per prøve for friskt vev, etterfølgende endringer i protokollen tillates FACS isolering av Fos-uttrykkende nevroner og kvantitativ polymerasekjedereaksjon (qPCR) analyse av diskrete hjerneområder fra en enkelt rotte 13-15 . Totalt sett unike molekylære endringer ble funnet i Fos-uttrykke nevroner aktiveres under en rekke kontekst og cue-aktivert atferd i avhengighet forskning 12,14,15. Et stort problem med logistikk utføre FACS på friskt vev, er at det tar en hel dag for å dissosiere vevet og fremgangsmåte ved FACS. I tillegg kan bare fire prøver behandles per dag. Dette betyr vanligvis at bare en hjerne område kan vurderes fra hver hjerne og de gjenværende områder av hjernen må kastes. Dette er et stort problem for lav gjennomstrømning atferds prosedyrer som for eksempel selvadministrasjon og utryddelse training som krever kirurgi og mange uker med intensiv trening. Videre er lange og kompliserte atferdsmessige prosedyrer på testdagen gjør det vanskelig å utføre FACS på den samme dag. Det ville være en vesentlig fordel å være i stand til å fryse hjernen fra dyrene umiddelbart etter adferdstesting, og deretter isolere Fos-uttrykkende nevroner fra ett eller flere områder av hjernen på forskjellige tider av undersøkerne har valgt ut. Her viser vi at vår FACS-protokollen kan bli benyttet for å isolere Fos-uttrykkende nevroner (og andre celletyper) fra både ferske og fryste hjernevev. Som et eksempel kan det isolert Fos-uttrykkende nevroner fra rotte-striatum etter akutt metamfetamin injeksjoner og fra naive rotter uten injeksjoner (kontroll tilstand). Men dette kan FACS protokollen brukes etter eventuelle atferds eller farmakologisk behandling. Påfølgende qPCR analyse av våre prøver indikerte at genuttrykk fra disse celletyper kan bli vurdert med simiLar effektivitet fra både fersk og frossen vev.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

Studiet av neuroplasticity og molekylære forandringer i lært atferd bytter fra studien av hele hjernen til studiet av bestemte sett med tynt fordelt aktiverte nerveceller kalles nevronale ensembler som formidler lært foreninger. Fluorescence Activated Cell Sorting (FACS) er nylig blitt optimalisert for voksent rottehjernevevet og tillot isolering av aktiverte neuroner ved hjelp av antistoffer mot neuronal markør Neun og Fos-proteinet, en markør for aktiverte sterkt neuroner. Inntil nå ble Fos-uttrykkende nevroner og andre celletyper isolert fra friskt vev, noe som medførte lange behandlings dager og tillates meget begrenset antall tilfeller av hjerne prøver som skal vurderes etter langvarige og kompliserte atferdsmessige prosedyrer. Her fant vi at utbyttet av Fos-uttrykke nevroner og Fos mRNA fra rygg striatum var lik mellom fersk dissekert vev og vev frosset ved -80 ºC i 3 - 21 dager. I tillegg har vi bekreftet fenotypenav de Neun-positive og Neun-negative sorterte cellene ved å vurdere genekspresjon av neuronal (Neun), astrocytic (GFAP), oligodendrocytic (Oligo2) og microgial (Iba1) markører, noe som indikerer at frosne vev kan også anvendes for FACS isolering av glial celletyper. Samlet sett er det mulig å samle inn, dissekere og fryse hjernevev for flere FACS økter. Dette maksimerer mengden av data innhentet fra verdifulle dyr fag som har ofte gjennomgått lange og komplekse atferdsprosedyrer.

Sortering Fos-positive og Fos-negative nevroner fra fersk og frossen dorsal striatum vev fra enkelt rotter etter akutte metamfetamin injeksjoner. Protokollen er beskrevet ovenfor ble anvendt for å sortere Fos-positive og Fos-negative nerveceller fra en enkelt rotte dorsal-striatum 90 minutter etter en intraperitoneal injeksjon av metamfetamin (5 mg / kg). Naive rotter i sine bur ble anvendt som kontroller. Dorsal striatum vev...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Her presenterer vi en Fluorescence Activated Cell Sortering (FACS) protokoll for å studere molekylære endringer i Fos-uttrykke nevrale ensembler fra både fersk og frossen hjernevev. Bruken av frossent vev tillater FACS isolering av mange hjernen områder over flere økter for å maksimere bruken av verdifulle dyr fag.

Fluorescence Activated Cell Sortering (FACS) og Gene Expression Analyse av Fos-uttrykker Nerveceller fra fersk og fryst Rat hjernevev

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Optimalisert Analyse av DNA-metylering og Gene Expression fra små, anatomisk definerte områder i hjernen

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

En Optimalisert Prosedyre for fluorescens-aktivert Cell Sorting (FACS) Isolering av Autonome Neural stamfedre fra Visceral organer Fetal Mus

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Laser Capture mikrodisseksjon av anriket Bestander av neuroner eller Enslige nevroner for genekspresjonsanalyse etter traumatisk hjerneskade

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

RNA-Seq Analyse av Differential Gene Expression i elektroporerte Chick Embryonic Spinal Cord

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

Primer for Immunhistokjemi på Cryosectioned Rat hjernevev: Eksempel Farging for Microglia og Nevroner

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Analyse av genuttrykk Endringer i Rat Hippocampus Etter dyp hjernestimulering av fremre talamiske Nucleus

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

Bruke fluorescensaktivert Cell Sorting å undersøke Cell-Type-Specific genuttrykk i Rat hjernevev

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Isolering av Cerebral kapillærer fra friske menneskelige hjernevev

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

Optimalisering av Laser-fangst Microdissection for isolering av innstigning Ganglion fra frisk-frosne menneskelig vev

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...