Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

Bütün deneyler Laboratuvar hayvanlarında 16 Bakımı ve Kullanımı için Sağlık Rehberi National Institutes of Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) göre gerçekleştirilmiştir. Not: Aksi belirtilmediği sürece, buz üzerinde tutulmuştur kullanımı, düşük bağlanma santrifüj tüpleri aşağıdaki tüm adımları. Doku Koleksiyonu önce 1. Hazırlık <ol><li> 4 o C santrifüj ayarlayın </li><li> Yangın lehçe...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS, taze ya da dondurulmuş yetişkin beyin dokusundan nöronlar ve diğer hücre tipleri sıralamak için kullanılabilir. Girişte belirtildiği gibi, donmuş doku kullanma yeteneği gibi bağımlılık araştırma öz-yönetim ve nüks çalışmaları gibi karmaşık ve uzun süreli davranış prosedürleri geçirmiş hayvanlardan numune optimum kullanımını sağlar. 2 saat ya da daha uzun süre ve tüm hayvanları gerektiren - Bu davranış prosedürler genellikle 1 sürer - aynı gün 13,18 test edil...

öğrenme sırasında, hayvanlar son derece spesifik uyaranların karmaşık setleri arasındaki ilişkileri oluşturmaktadır. Bu yüksek çözünürlüklü bilgi nöronal topluluklar olarak adlandırılan seyrek dağıtılan nöronların belirli kalıpları içinde değişikliklerle tarafından kodlanan olduğu düşünülmektedir. Nöronal toplulukları son zamanlarda güçlü davranış veya isteka pozlama sırasında aktive edildi gibi Fos, Arc ve Zif268 ve nöronlarda protein ürünleri gibi hemen erken genlerin (Bacaklarını) indüksiyonu ile tespit edilmiştir. Özellikle içerik ve işaret özgü öğrenilen davranışlar 1-4 nedensel rol oynadığı gösterilmiştir nöronlar Fos-dile getirdi. Bu nedenle, bu aktive Fos-ifade nöronlar içinde benzersiz moleküler neuroadaptations madde bağımlılığı ve post-travmatik stres bozukluğu (TSSB) 5 normal öğrenme ve anormal öğrenme bozuklukları sırasında oluşan dernek, öğrenilen enkode nöral mekanizmalar için en iyi adaylardır. Fluorescence Aktif Hücre Sıralama (FACS) son zamanlarda Fos-ifade nöronlar içinde benzersiz moleküler neuroadaptations analizi izin verdi. Flow sitometri ve hücre kendi ışık saçılması ve immunofluorescent özelliklerine göre hücre karakterize ve izole etmek için 1960 6,7 geliştirilmiştir sıralama ve uzun immünoloji ve kanser araştırmalarında kullanılmaktadır. Ancak akım sitometri ve FACS yetişkin beyin dokusundan elde etmek zordur ayrışmış tek hücreleri gerektirir. FACS birinci antikor etiketleme 8,9 gerektirmeyen transjenik farelerden striatal nöronlar -expressing izole etmek ve (GFP) yeşil floresan protein analiz etmek için kullanıldı. Bu izole edilmesi ve vahşi tip hayvanlara 11-15 ilaç ve / veya ipuçları ile aktive nöronlar Fos eksprese eden moleküler değişikliklerin değerlendirilmesi için antikor bazlı FACS metodu ile 10 geliştirilmiştir. güçlü nöronlar aktive ederken, bu yöntemde, nöronlar, genel nöronal belirteç neun karşı bir antikor ile etiketlenirFos karşı bir antikor ile etiketlenir. Başlangıçtaki yöntem, taze doku için örnek başına 10 sıçan havuzu gerekli olsa da, bir protokolün takip eden değişiklikler tek sıçan 13-15 ayrık beyin alanlarının Fos salgılayan nöronların ve kantitatif Polimeraz Zincir Reaksiyonu (qPCR) analizi FACS izole izin . Genel olarak, eşsiz moleküler değişiklikler bağımlılığı araştırma 12,14,15 yılında bağlam ve işaret aktive davranışlar çeşitli sırasında aktive nöronlar Fos-ifade bulundu. Taze doku üzerinde FACS performans ile büyük lojistik sorun FACS ile doku ve süreci ayırmak bir bütün gün sürer olmasıdır. Buna ek olarak, sadece dört numune günde işlenebilir. Bu, genellikle tek bir beyin bölgesi Her beyinden gelen değerlendirilebilir ve kalan beyin bölgeleri iptal edilmesi gerektiği anlamına gelir. Bu tür öz-yönetim ve nesli trai gibi düşük verimlilik davranışsal işlemler için önemli bir sorundurcerrahi ve yoğun bir eğitim birçok hafta gerekir ning. Bundan başka, test gününde, uzun ve karmaşık bir davranış işlemler zor aynı gün FACS yapılmasını kolaylaştırır. Bu önemli bir avantaj hemen davranışsal test ettikten sonra hayvanlardan beyinleri dondurmak mümkün olacak, ve sonra araştırıcının seçeceği farklı zamanlarda bir veya birden fazla beyin bölgelerinden Fos-ifade nöronlar izole olacaktır. Burada biz, FACS protokolü taze ve dondurulmuş, her iki beyin dokusundan Fos salgılayan nöronların (ve diğer hücre tipleri) izole etmek için kullanılabileceğini gösterir. Bir örnek olarak, akut metamfetamin enjeksiyondan sonra ve enjeksiyonlar (kontrol koşulu olmadan) naif sıçanların sıçan striatum nöronları Fos-ifade izole. Bununla birlikte, bu FACS protokolü bir davranış ya da farmakolojik tedavi sonrası kullanılabilir. Bizim örneklerin sonraki qPCR analizi bu hücre tiplerinden gen ifadesi simi ile değerlendirilebilir olabileceğini belirttitaze ve dondurulmuş hem dokudan lar verimliliği.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

nöroplastisite ve öğrenilmiş davranışların moleküler değişikliklerin çalışma dernekleri öğrenilen aracılık eden nöronal topluluklar olarak adlandırılan seyrek dağıtılan aktif nöronların spesifik setleri çalışmaya tüm beyin bölgelerinin çalışma geçiyor. (FACS) Kontrol THP-en son yetişkin fare beyin dokusu için optimize edilmiş ve nöronal marker NeuN ve fos protein güçlü aktif nöronların belirteci karşı antikorlar kullanılarak aktif nöronların izolasyonu izin verildi. Şimdiye kadar, Fos salgılayan nöronların ve diğer hücre tipleri uzun işlem günü ve uzun ve karmaşık davranış işlemlerinden sonra değerlendirilir beyin örnekleri izin çok kısıtlı gerektirdiği taze doku, izole edilmiştir. 21 gün - Burada dorsal striatum nöronlar ve Fos mRNA Fos-ifade verimleri 3 -80 ºC de donduruldu taze disseke doku ve doku arasındaki benzer olduğunu gördük. Buna ek olarak, fenotip teyitdondurulmuş doku, aynı zamanda, FACS izolasyonu için kullanılabileceğini gösterir nöronal değerlendirmek gen ifadesi (NeuN), astrositik (GFAP), oligodendrocytic (Oligo2) ve microgial (Iba1) işaretleri ile NeuN-pozitif ve NeuN negatif kriteri hücrelerin glial hücre türleri. Genel olarak, toplamak incelemek ve birden FACS oturumları için beyin dokusu dondurmak mümkün. Bu genellikle uzun ve karmaşık davranışsal prosedürleri geçirmiş değerli hayvan deneklerden elde edilen verilerin miktarını en üst düzeye çıkarır.

akut metamfetamin enjeksiyondan sonra tek sıçanların taze ve dondurulmuş dorsal striatum dokudan Fos-pozitif ve Fos-negatif nöronlar sıralama. Yukarıda tarif edilen protokol metamfetamin (5 mg / kg) periton içinden enjekte sonra bir sıçan dorsal striatum, 90 dakika arasında Fos-pozitif ve fos-negatif nöronlar sıralamak için kullanıldı. kendi kafeslerinde naiv sıçanlar kontrol olarak kullanıldı. Dorsal stria...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Burada taze ve dondurulmuş hem de beyin dokusundan nöronal topluluklarından Fos-ifade moleküler değişiklikler incelemek için bir Floresan Aktif Hücre Sıralama (FACS) protokol mevcut. dondurulmuş doku kullanımı değerli hayvan deneklerin kullanımını maksimize için birden fazla seans boyunca birçok beyin bölgelerinin FACS izolasyonu sağlar.

Floresan Aktif Hücre Sıralama (FACS) ve Taze ve Dondurulmuş Rat Beyin Dokusu gelen Fos-ifade nöronlar Gen İfadesi Analizi

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

Research

JoVE Journal

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Çift Floresans In situ Taze Beyin Bölüm Hibridizasyon

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Beyin Küçük, Anatomik tanımlı alanları DNA metilasyon ve Gen İfade Optimize Analizi

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

Fetal Fare Visseral Organlardan Otonom Sinir progenitörlerin Floresans aktive Hücre Sıralama (FACS) İzolasyon için bir optimize Prosedürü

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Travmatik Beyin Hasarı Sonrası Nöronlar veya gen ekspresyon analizi için Tek Nöron zenginleştirilmiştir Populasyonlarının Lazer Yakalama Mikrodisseksiyon

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

RNA-Seq Analysis of Differential Gene Expression in Electroporated Chick Embryonic Spinal Cord

Electroporated Chick Embriyonik Omurilik Diferansiyel Gen İfade RNA Sıra Analizi

In ovo electroporation of the chick neural tube is a fast and inexpensive method for identification of gene function during neural development. Genome ...

Primer for Immunohistochemistry on Cryosectioned Rat Brain Tissue: Example Staining for Microglia and Neurons

Mikroglia ve nöronlar için örnek Boyama: Cryosectioned Rat Beyin Dokusu Üzerine İmmünohistokimya için Astar

Immunohistochemistry is a widely used technique for detecting the presence, location, and relative abundance of antigens in situ. This introductory level ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Ön Talamusun Çekirdek Derin Beyin Stimülasyon sonra Sıçan Hippocampus Gen İfade Değişim Analizi

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

Sıçan beyin dokusunda incelemek için THP kullanılarak hücre-tipi-spesifik gen ifadesi

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Yalıtım taze insan beyin dokusundan beyin kapiller

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

Lazer-yakalama mikrodiseksiyon optimizasyonu gelen insan dokusu taze donmuş enterik gangliyon yalıtım için

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...