Name: flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma
Uploaded: 2017-06-10T13:00:00
Description: Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Le développement de cette méthode de projet a été financé par le Département de pathologie et de médecine de laboratoire du Collège médical Weill Cornell. Nous reconnaissons le programme de formation tri-institutionnelle en biologie et médecine computationnelle pour un financement partiel. Nous tenons à remercier les scientifiques qui ont partagé leur temps et nos connaissances avec nous, en particulier Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; Et tous les membres du Weill Cornell Medical College Genomics Core Facility, y compris Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson et Tuo Zhang.

1. Traitement et congélation des tissus <ol><li> Recueillir des tissus ganglionnaires dans du sérum physiologique tamponné au phosphate (PBS) ou au milieu de l&#39;Institut Roswell Park Memorial (RPMI) et traiter dans les 24 h de la collecte. Transférer le tissu de ganglion lymphatique excisé 9 dans une boîte de Pétri contenant 10 mL de RPMI avec 2% de sérum de veau fœtal (FCS) et l&#39;hacher finement avec une lame de scalpel fraîche. Utilisez le dos d&#39;un piston de seringue de 10...

<ol>
	<li>Abrams, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=National+Cancer+Institute's+Precision+Medicine+Initiatives+for+the+new+National+Clinical+Trials+Network.">National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.</a> American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).</li><li>Gagan, J., Van Allen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+sequencing+to+guide+cancer+therapy.">Next-generation sequencing to guide cancer therapy.</a> Genome medicine. 7, 80 (2015).</li><li>Matsuki, E., Younes, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphomagenesis+in+Hodgkin+lymphoma.">Lymphomagenesis in Hodgkin lymphoma.</a> Seminars in cancer biology. 34, 14-21 (2015).</li><li>Fromm, J. R., Kussick, S. J., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+purification+of+classical+Hodgkin+cells+from+lymph+nodes+by+flow+cytometry+and+flow+cytometric+cell+sorting.">Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting.</a> Am J Clin Pathol. 126 (5), 764-780 (2006).</li><li>Fromm, J. R., Thomas, A., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+can+diagnose+classical+hodgkin+lymphoma+in+lymph+nodes+with+high+sensitivity+and+specificity.">Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity.</a> Am J Clin Pathol. 131 (3), 322-332 (2009).</li><li>Roshal, M., Wood, B. L., Fromm, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+detection+of+the+classical+hodgkin+lymphoma:+clinical+and+research+applications.">Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications.</a> Advances in hematology. 2011, 387034 (2011).</li><li>Reichel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+sorting+and+exome+sequencing+reveal+the+oncogenome+of+primary+Hodgkin+and+Reed-Sternberg+cells.">Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.</a> Blood. 125 (7), 1061-1072 (2015).</li><li>Kozarewa, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Modified+Method+for+Whole+Exome+Resequencing+from+Minimal+Amounts+of+Starting+DNA.">A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA.</a> PLoS ONE. 7 (3), e32617 (2012).</li><li>Brunicardi, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Schwartz's Principles of Surgery. , (2014).</li><li>Kantor, A. B., Roederer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+analysis+of+leukocytes.">FACS analysis of leukocytes.</a> Handbook of Experimental Immunology. 2, (1996).</li><li>Sanders, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways+of+adhesion+in+spontaneous+rosetting+of+T-lymphocytes+to+the+Hodgkin's+cell+line+L428.">Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428.</a> Cancer Res. 48 (1), 37-40 (1988).</li><li>Biosciences. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).</li><li>. Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/Q33216">https://www.thermofisher.com/order/catalog/product/Q33216</a> (2017)</li><li>Roche Nimblegen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).</li><li>Li, H., Durbin, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+accurate+short+read+alignment+with+Burrows-Wheeler+transform.">Fast and accurate short read alignment with Burrows-Wheeler transform.</a> Bioinformatics. 25 (14), 1754-1760 (2009).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Saunders, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strelka:+accurate+somatic+small-variant+calling+from+sequenced+tumor-normal+sample+pairs.">Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.</a> Bioinformatics. 28 (14), 1811-1817 (2012).</li><li>Cingolani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+program+for+annotating+and+predicting+the+effects+of+single+nucleotide+polymorphisms,+SnpEff:+SNPs+in+the+genome+of+Drosophila+melanogaster+strain+w1118;+iso-2;+iso-3.">A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.</a> Fly (Austin). 6 (2), 80-92 (2012).</li><li>Dobin, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Briefings in bioinformatics. 14 (2), 178-192 (2013).</li><li>. DNA copy number data analysis. v.R package version 1.34.0 Available from: <a target="_blank" href="https://omictools.com/dnacopy-tool">https://omictools.com/dnacopy-tool</a> (2013)</li></ol>

Applications ou directions futures après maîtriser cette technique Ce travail permet un exoma de séquençage à partir d&#39;échantillons contenant au moins 10 ng d&#39;ADN. Dans le contexte clinique, cette limite exclut la plupart des échantillons d&#39;aspiration à l&#39;aiguille fine en raison d&#39;un matériel insuffisant, mais comprend des biopsies de noyau adéquates et des échantillons de biopsie excisionnelle. Cela permettra l&#39;acquisition de données à p...

<html> Les progrès dans la génomique du cancer à la suite du séquençage de la prochaine génération ont conduit à des percées significatives dans l&#39;identification des cibles thérapeutiques et dans le pronostic pour de nombreux néoplasmes hématologiques et non hématologiques. De nouvelles stratégies de traitement individualisées basées sur des modifications génomiques spécifiques sont rapidement introduites dans de nombreux types de tumeurs (examinés dans les références 1 , 2 ). Malgré des progrès significatifs dans la génomique des lymphomes, le génome des cellules HRS néoplasiques dans le lymphome Hodgkin classique (CHL) avait été sous-exploré. Les recherches ont été entravées par la pénurie de cellules HRS néoplasiques dans un micro-environnement réactif, ce qui rend difficile l&#39;isolement des populations de cellules HRS purifiées 3 . La méthode pour isoler des cellules HRS viables à partir de tumeurs primaires a été développée par Fromm et al. 4 ,La méthode utilise un cocktail à huit anticorps, composé de CD30, CD15, CD40, CD95, CD45 CD20, CD5 et CD64, pour identifier de manière non équivoque les cellules HRS à partir d&#39;une suspension de tumeur CHL. En utilisant cette méthodologie, nous Sont capables d&#39;isoler au moins 1 000 cellules HRS viables à partir de suspensions cellulaires fraîches ou congelées à partir de biopsies tumorales constituées d&#39;au moins 10 cellules (environ 10 mg de tissu). La pureté est supérieure à 90% par analyse cytométrique en flux et est estimée comme étant Au moins 80% par une analyse génomique exome de dix cas consécutifs. Nous avons raffiné une technique d&#39;isolement de cellules cytométriques en flux qui a considérablement facilité le processus, ce qui permet l&#39;isolement rapide de milliers de cellules HRS viables à partir de tumeurs CHL primaires 7 . Nous avons utilisé la technique pour produire ce qui est censé être la première séquence complète des cellules tumorales dans les cas primaires de lymphome de Hodgkin. Nos études démontrent queLa faisabilité des études à grande échelle sur le génome des cas individuels de la LCH et ont déjà conduit à l&#39;identification de nouvelles altérations génomiques avec le potentiel d&#39;expliquer les aspects de la pathogenèse de la LCH. Nous avons développé un pipeline pour utiliser l&#39;ADN extrait pour des études génomiques à haut débit. Afin d&#39;obtenir des résultats fiables à partir de 1 000 cellules HRS triées (le minimum obtenu à partir de cas séquentiels), nous avons développé une procédure de construction de bibliothèque d&#39;ADN de prochaine génération modifiée 8 qui nous a permis d&#39;augmenter l&#39;efficacité de ligature d&#39;adaptateur et de générer des bibliothèques de fragments d&#39;ADN Sans amplification excessive. Cette méthode permet l&#39;analyse d&#39;échantillons cliniques de routine et la détection de mutations récurrentes et d&#39;altérations chromosomiques 7 .

<table border="0" cellpadding="0" cellspacing="0" width="1576">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Petri or Cell Culture Dish (sterile)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td style="width:535px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">RPMI-1640 Media</td>
			<td>Roswell Park Memorial Institute</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal Calf Serum (FCS), (heat inactivated)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI with 2% FCS (make fresh or store for up to 1 month)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">scalpel with fresh blade</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 ml syringe (no needle)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryogenic vials</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical centrifuge tubes, force</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td>capable of handling 50 ml conical centrifuge tubes and providing 400g</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes buffer(1M, cell culture grade)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">phosphate buffered saline (PBS)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pluoronic-F68</td>
			<td style="width:352px;">Thermo-Fisher</td>
			<td style="width:119px;">24040-032</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAase-I</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">D4527-10KU</td>
			<td>store as 5mg/ml in RPMI in -200C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic &#8211;F68 (1X))</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD64-FITC (22)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD30-PE (BerH83)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD5-ECD (BL1a)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD40-PerCP-eFluor 710 (1C10)</td>
			<td style="width:352px;">Ebiosciences, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD20-PC7 (B9E9)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD15-APC (HI98)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD45 APC-H7 (2D1)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD95-Pacific Blue (DX2)</td>
			<td style="width:352px;">Life Technologies, Grand Island, NY</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD2 (5 &#956;g; clone RPA-2.10)</td>
			<td style="width:352px;">Biolegend, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD54 (10 &#956;g; clone 84H10)</td>
			<td style="width:352px;">Serotec, Oxford, United Kingdom</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD58 (10 &#956;g; clone TS2/9)</td>
			<td style="width:352px;">eBioscience, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LFA-1 (12 &#956;g; clone MHM23)</td>
			<td style="width:352px;">Novus Biologicals, Littleton, CO</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD CS&#38;T Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accudrop Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BC Versa Comp antibody capture beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>Compensation Beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD-FACS ARIA special research order instrument using 5 lasers</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Wizard</td>
			<td style="width:352px;">Promega</td>
			<td>A2360</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 mM Tris-Cl buffer</td>
			<td style="width:352px;">NA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit dsDNA HS Assay kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">S2 Sonicator</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td>Alternatives may be substituted</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">microTUBE</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low-Throughput Library Preparation Kit</td>
			<td style="width:352px;">Kapa Biosystems, Wilmington, MA</td>
			<td>KK8221</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Sybr Green</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">S9430</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Agencourt AMPure XP Beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Bioanalyzer</td>
			<td style="width:352px;">Agilent Technologies, Santa Clara, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqCap EZ Exome v.3.0</td>
			<td style="width:352px;">Roche Nimblegen</td>
			<td style="width:119px;">6465684001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">HiSeq</td>
			<td style="width:352px;">Illumina</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style Universal adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style index adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 1</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>AATGATACGGCGACCACCGAGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 2</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>CAAGCAGAAGACGGCATACGAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Nuclease Free Duplex Buffer</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD FACSDIVA software</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Falcon Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Flow Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma

Les cellules Hodgkin Reed-Sternberg du lymphome de Hodgkin classique sont dispersées dans un fond de lymphocytes inflammatoires et comprennent généralement moins de 1% de la masse tumorale. Les matières dérivées de la tumeur en vrac contiennent une teneur en tumeur à une concentration insuffisante pour la caractérisation. Par conséquent, le tri cellulaire activé par fluorescence utilisant huit anticorps, ainsi que des dispersions latérales et antérieures, est décrit ici comme une méthode de séparation rapide et de concentration avec des milliers de cellules HRS à haute pureté de la tumeur pour une étude ultérieure. Dans le même temps, car les protocoles standard pour le séquençage exome nécessitent généralement 100-1 000 ng d&#39;ADN d&#39;entrée, ce qui est souvent trop élevé, même avec le tri de flux, nous fournissons également un protocole de construction de bibliothèque optimisé et à faible entrée capable de produire une qualité élevée Des données provenant de seulement 10 ng d&#39;ADN d&#39;entrée. Cette combinaison est capable de produire des bibliothèques de prochaine génération adaptées à la capture d&#39;hybridation de tout-eXome appâts ou plus ciblés panneaux ciblés, comme désiré. Exome du séquençage des cellules HRS, comparées aux cellules T ou B intratumorales saines, peuvent identifier les altérations somatiques, y compris les mutations, les insertions et les suppressions, et les modifications des numéros de copies. Ces résultats expliquent la biologie moléculaire des cellules HRS et peuvent révéler des voies pour les traitements ciblés.

Un diagramme de bioanalyseur devrait être pris après l&#39;amplification de la bibliothèque et le nettoyage des perles 0,8x. On devrait voir une distribution &quot;normale&quot; des tailles de fragments dans la gamme souhaitée ( Figure 2a ). Les écarts par rapport à cette forme, tels qu&#39;un &quot;épaule&quot; visible dans la courbe, indiquent la présence d&#39;un artefact de poids moléculaire élevé ou faible. Par exemple, la <strong class="xfig...

Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Ici, nous décrivons un protocole de calcul de la cellule de cytométrie à flux combiné et un protocole de construction de bibliothèque de prochaine génération conçu pour produire des données de haute qualité et exhaustives des cellules Hodgkin Reed-Sternberg (HRS) du lymphome de Hodgkin classique (CHL).

Le tri de flux et le séquençage Exome des cellules de Reed-Sternberg du lymphome de Hodgkin classique

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically ...

Research

JoVE Journal

Genetics

Detection of Copy Number Alterations Using Single Cell Sequencing

Détection de Copy Number Transformations Utilisation unique cellule de séquençage

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Recherche

Génétique

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Analyse transcriptomique de<em&gt; C</em&gt;.<em&gt; elegans</em&gt; RNA séquençage des données par le Tuxedo Suite sur le projet Galaxy

Next generation sequencing (NGS) technologies have revolutionized the nature of biological investigation. Of these, RNA Sequencing (RNA-Seq) has emerged ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq : Une haut débit basée sur le séquençage Technique d’identification tard reproduisant des régions du génome

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Isolement d’ADN robuste et Construction de bibliothèque de séquençage haut-débit pour les spécimens d’herbier

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Amplification de près de provirus pleine longueur de VIH-1 pour l’ordonnancement de prochaine génération

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

High-throughput Identification des séquences régulatrices du gène à l’aide de prochaine génération séquençage du Chromosome circulaire Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Isoler, séquençage et l’analyse des microARN extracellulaires de cellules souches mésenchymateuses humaines

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

Un écran de suppresseur de Deep-séquençage-assisted, spontanée chez la levure Scissipare Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Semiconductor Sequencing for Preimplantation Genetic Testing for Aneuploidy

Séquençage des semi-conducteurs pour les tests génétiques préimplantatoires pour l'anéuploidy

Chromosomal aneuploidy, one of the main causes leading to embryonic development arrest, implantation failure, or pregnancy loss, has been well documented ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Séquençage de l’ARNm de sang total à l’aide du séquençage NANOPORE

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...