Name: flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma
Uploaded: 2017-06-10T13:00:00
Description: Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Lo sviluppo di questo metodo di progetto è stato finanziato dal Dipartimento di Patologia e Medicina di Laboratorio di Weill Cornell Medical College. Riconosciamo il programma triennale di formazione in biologia e medicina computazionale per un finanziamento parziale. Vorremmo ringraziare gli scienziati che hanno condiviso il loro tempo e conoscenza con noi, in particolare Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; E tutti dal Wemel Cornell Medical Center, tra cui Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson e Tuo Zhang.

1. Tissue Processing e Congelamento <ol><li> Raccogliere il tessuto dei linfonodi in soluzione salina fosfatica (PBS) o Roswell Park Memorial Institute (RPMI) e procedere entro 24 ore dalla raccolta. Trasferire il tessuto linfonodale ecceduto 9 in un piatto di Petri contenente 10 mL di RPMI con il siero di vitello fetale del 2% (FCS) e finemente tritarlo con una lama di bisturi fresca. Utilizzare il dorso di uno stantuffo da 10 ml per smerigliare / dissociare il tessuto. </li><li> Trasferire il...

<ol>
	<li>Abrams, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=National+Cancer+Institute's+Precision+Medicine+Initiatives+for+the+new+National+Clinical+Trials+Network.">National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.</a> American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).</li><li>Gagan, J., Van Allen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+sequencing+to+guide+cancer+therapy.">Next-generation sequencing to guide cancer therapy.</a> Genome medicine. 7, 80 (2015).</li><li>Matsuki, E., Younes, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphomagenesis+in+Hodgkin+lymphoma.">Lymphomagenesis in Hodgkin lymphoma.</a> Seminars in cancer biology. 34, 14-21 (2015).</li><li>Fromm, J. R., Kussick, S. J., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+purification+of+classical+Hodgkin+cells+from+lymph+nodes+by+flow+cytometry+and+flow+cytometric+cell+sorting.">Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting.</a> Am J Clin Pathol. 126 (5), 764-780 (2006).</li><li>Fromm, J. R., Thomas, A., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+can+diagnose+classical+hodgkin+lymphoma+in+lymph+nodes+with+high+sensitivity+and+specificity.">Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity.</a> Am J Clin Pathol. 131 (3), 322-332 (2009).</li><li>Roshal, M., Wood, B. L., Fromm, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+detection+of+the+classical+hodgkin+lymphoma:+clinical+and+research+applications.">Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications.</a> Advances in hematology. 2011, 387034 (2011).</li><li>Reichel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+sorting+and+exome+sequencing+reveal+the+oncogenome+of+primary+Hodgkin+and+Reed-Sternberg+cells.">Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.</a> Blood. 125 (7), 1061-1072 (2015).</li><li>Kozarewa, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Modified+Method+for+Whole+Exome+Resequencing+from+Minimal+Amounts+of+Starting+DNA.">A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA.</a> PLoS ONE. 7 (3), e32617 (2012).</li><li>Brunicardi, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Schwartz's Principles of Surgery. , (2014).</li><li>Kantor, A. B., Roederer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+analysis+of+leukocytes.">FACS analysis of leukocytes.</a> Handbook of Experimental Immunology. 2, (1996).</li><li>Sanders, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways+of+adhesion+in+spontaneous+rosetting+of+T-lymphocytes+to+the+Hodgkin's+cell+line+L428.">Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428.</a> Cancer Res. 48 (1), 37-40 (1988).</li><li>Biosciences. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).</li><li>. Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/Q33216">https://www.thermofisher.com/order/catalog/product/Q33216</a> (2017)</li><li>Roche Nimblegen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).</li><li>Li, H., Durbin, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+accurate+short+read+alignment+with+Burrows-Wheeler+transform.">Fast and accurate short read alignment with Burrows-Wheeler transform.</a> Bioinformatics. 25 (14), 1754-1760 (2009).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Saunders, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strelka:+accurate+somatic+small-variant+calling+from+sequenced+tumor-normal+sample+pairs.">Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.</a> Bioinformatics. 28 (14), 1811-1817 (2012).</li><li>Cingolani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+program+for+annotating+and+predicting+the+effects+of+single+nucleotide+polymorphisms,+SnpEff:+SNPs+in+the+genome+of+Drosophila+melanogaster+strain+w1118;+iso-2;+iso-3.">A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.</a> Fly (Austin). 6 (2), 80-92 (2012).</li><li>Dobin, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Briefings in bioinformatics. 14 (2), 178-192 (2013).</li><li>. DNA copy number data analysis. v.R package version 1.34.0 Available from: <a target="_blank" href="https://omictools.com/dnacopy-tool">https://omictools.com/dnacopy-tool</a> (2013)</li></ol>

Applicazioni future o indicazioni dopo masterizzazione di questa tecnica Questo lavoro consente di sequenziare exome da campioni contenenti almeno 10 ng di DNA. Nel contesto clinico, questo limite esclude la maggior parte dei campioni di aspirazione a fine ago a causa di materiale insufficiente, ma comprende adeguate biopsie di base e campioni di biopsia excisa. Ciò consentirà l&#39;acquisizione di dati da un insieme più ampio di campioni possibili. <p class="jove_con...

<html> Gli avanzamenti nella genomica del cancro a seguito della sequenza di prossima generazione hanno portato a significativi progressi nell&#39;identificazione di bersagli terapeutici e nella prognosticazione di molte neoplasie ematologiche e non ematologiche. Nuove strategie di trattamento individualizzate basate su alterazioni genomiche specifiche vengono rapidamente introdotte in molti tipi di tumori (esaminati nei riferimenti 1 , 2 ). Nonostante un notevole progresso nella genomica del linfoma, il genoma delle cellule HRS neoplastiche nel linfoma classico di Hodgkin (CHL) era stato indebolito. Le indagini sono state ostacolate dalla scarsità di cellule HRS neoplastiche all&#39;interno di un microambiente reattivo, rendendo difficile l&#39;isolamento delle popolazioni cellulari HRS purificate 3 . Il metodo per isolare cellule HRS vitali da tumori primari è stato sviluppato da Fromm et al. 4 ,Ref &quot;&gt; 5 , 6. Il metodo utilizza un cocktail di otto anticorpi, composto da CD30, CD15, CD40, CD95, CD45 CD20, CD5 e CD64, per identificare in modo inequivocabile le cellule HRS da una sospensione tumorale CHL. Sono in grado di isolare almeno 1000 cellule HRS vitali dalle sospensioni cellulari fresche o congelate da biopsie tumorali costituite da almeno 10 cellule (circa 10 mg di tessuto). La purezza è superiore al 90% mediante analisi citometrica a flusso e si stima che sia Almeno 80% da analisi genomica exome di dieci casi consecutivi. Abbiamo raffinato una tecnica di isolamento delle cellule citometriche di flusso che ha notevolmente facilitato il processo, consentendo il rapido isolamento di migliaia di cellule HRS vitali da tumori primari CHL 7 . Abbiamo utilizzato la tecnica per produrre quello che si crede essere la prima sequenza di esomeri intero delle cellule tumorali nei casi primari del linfoma di Hodgkin. I nostri studi dimostrano thLa fattibilità di studi di elevata produttività e genoma su singoli casi di CHL e hanno già portato all&#39;identificazione di nuove alterazioni genomiche con il potenziale per spiegare aspetti della patogenesi CHL. Abbiamo ulteriormente sviluppato una pipeline per utilizzare il DNA estratto per studi genomici ad alto rendimento. Al fine di ottenere risultati affidabili da ben 1000 cellule HRS ordinate (il minimo ottenuto da casi sequenziali), abbiamo ulteriormente sviluppato una procedura di costruzione della libreria di DNA di nuova generazione 8 che ci ha permesso di aumentare l&#39;efficienza della legatura dell&#39;adattatore e di generare librerie di frammenti di DNA Senza amplificazione eccessiva. Questo metodo consente l&#39;analisi di campioni clinici di routine e la rilevazione di mutazioni ricorrenti e alterazioni cromosomiche 7 .

<table border="0" cellpadding="0" cellspacing="0" width="1576">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Petri or Cell Culture Dish (sterile)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td style="width:535px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">RPMI-1640 Media</td>
			<td>Roswell Park Memorial Institute</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal Calf Serum (FCS), (heat inactivated)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI with 2% FCS (make fresh or store for up to 1 month)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">scalpel with fresh blade</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 ml syringe (no needle)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryogenic vials</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical centrifuge tubes, force</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td>capable of handling 50 ml conical centrifuge tubes and providing 400g</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes buffer(1M, cell culture grade)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">phosphate buffered saline (PBS)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pluoronic-F68</td>
			<td style="width:352px;">Thermo-Fisher</td>
			<td style="width:119px;">24040-032</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAase-I</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">D4527-10KU</td>
			<td>store as 5mg/ml in RPMI in -200C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic &#8211;F68 (1X))</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD64-FITC (22)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD30-PE (BerH83)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD5-ECD (BL1a)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD40-PerCP-eFluor 710 (1C10)</td>
			<td style="width:352px;">Ebiosciences, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD20-PC7 (B9E9)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD15-APC (HI98)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD45 APC-H7 (2D1)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD95-Pacific Blue (DX2)</td>
			<td style="width:352px;">Life Technologies, Grand Island, NY</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD2 (5 &#956;g; clone RPA-2.10)</td>
			<td style="width:352px;">Biolegend, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD54 (10 &#956;g; clone 84H10)</td>
			<td style="width:352px;">Serotec, Oxford, United Kingdom</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD58 (10 &#956;g; clone TS2/9)</td>
			<td style="width:352px;">eBioscience, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LFA-1 (12 &#956;g; clone MHM23)</td>
			<td style="width:352px;">Novus Biologicals, Littleton, CO</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD CS&#38;T Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accudrop Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BC Versa Comp antibody capture beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>Compensation Beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD-FACS ARIA special research order instrument using 5 lasers</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Wizard</td>
			<td style="width:352px;">Promega</td>
			<td>A2360</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 mM Tris-Cl buffer</td>
			<td style="width:352px;">NA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit dsDNA HS Assay kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">S2 Sonicator</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td>Alternatives may be substituted</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">microTUBE</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low-Throughput Library Preparation Kit</td>
			<td style="width:352px;">Kapa Biosystems, Wilmington, MA</td>
			<td>KK8221</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Sybr Green</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">S9430</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Agencourt AMPure XP Beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Bioanalyzer</td>
			<td style="width:352px;">Agilent Technologies, Santa Clara, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqCap EZ Exome v.3.0</td>
			<td style="width:352px;">Roche Nimblegen</td>
			<td style="width:119px;">6465684001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">HiSeq</td>
			<td style="width:352px;">Illumina</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style Universal adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style index adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 1</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>AATGATACGGCGACCACCGAGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 2</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>CAAGCAGAAGACGGCATACGAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Nuclease Free Duplex Buffer</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD FACSDIVA software</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Falcon Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Flow Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma

Le cellule Hodgkin Reed-Sternberg del linfoma classico di Hodgkin sono distribuite scarsamente in uno sfondo di linfociti infiammatorie e tipicamente contengono meno dell&#39;1% della massa tumorale. Il materiale derivato da tumore sfuso contiene il contenuto di tumore ad una concentrazione insufficiente per la caratterizzazione. Pertanto, la classificazione delle cellule attivata con fluorescenza usando otto anticorpi, così come spostamento laterale e in avanti, è descritta qui come un metodo di separazione rapida e concentrazione con migliaia di cellule HRS di alta purezza del tumore per il successivo studio. Allo stesso tempo, poiché i protocolli standard per il sequenziamento di exome richiedono tipicamente 100-1.000 ng di DNA in ingresso, spesso troppo elevato, anche con l&#39;ordinamento dei flussi, forniamo anche un protocollo di costruzione della biblioteca ottimizzato e basso in grado di produrre una qualità Dati da appena 10 ng di DNA in ingresso. Questa combinazione è in grado di produrre librerie di nuova generazione adatte alla cattura di ibridazione di interi eXome baits o pannelli mirati più mirati, come desiderato. La sequenza di Exome delle cellule HRS, se confrontata con le cellule T o B intratecorali, può identificare alterazioni somatiche, comprese le mutazioni, le inserzioni e le delezioni e le alterazioni del numero di copie. Questi risultati illustrano la biologia molecolare delle cellule HRS e possono rivelare vie per trattamenti farmacologici mirati.

Una trama di bioanalizzatore dovrebbe essere presa dopo l&#39;amplificazione della biblioteca e la pulizia del branello 0.8x. Si dovrebbe vedere una distribuzione &quot;di tipo normale&quot; di dimensioni del frammento nell&#39;intervallo desiderato ( Figura 2a ). Le deviazioni da questa forma, come una &quot;spalla&quot; visibile nella curva, indicano la presenza di un artefatto di peso alto o basso. Ad esempio, la Figura 2b <s...

Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Qui descriviamo un sistema di classificazione delle celle citometriche a flusso combinato e un protocollo di costruzione della libreria di nuova generazione, progettato per produrre dati di alta qualità e di esito intero dalle cellule Hodgkin Reed-Sternberg (HRS) del linfoma classico Hodgkin (CHL).

Selezione del flusso e sequenza di Exome delle cellule Reed-Sternberg del linfoma classico di Hodgkin

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically ...

Research

JoVE Journal

Genetics

Detection of Copy Number Alterations Using Single Cell Sequencing

Rilevamento di Copy Number Alterazioni Utilizzando Sequencing Single Cell

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Ricerca

Genetica

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Analisi trascrittomica di<em&gt; C</em&gt;.<em&gt; elegans</em&gt; RNA Sequencing dati attraverso la suite Tuxedo sul Progetto Galaxy

Next generation sequencing (NGS) technologies have revolutionized the nature of biological investigation. Of these, RNA Sequencing (RNA-Seq) has emerged ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: Un'elevato Throughput sequenziamento-base tecnica per identificare replica ritardata regioni del genoma

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Isolamento del DNA robusto e costruzione della libreria High-throughput sequenziamento per campioni di erbario

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Amplificazione del vicino full-length provirus di HIV-1 per il sequenziamento di nuova generazione

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Identificazione di High-throughput di sequenze regolatorie del Gene mediante sequenziamento di nuova generazione di cromosoma circolare conformazione catturare (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Isolare, sequenziamento e analisi dei microRNA extracellulari dalle cellule staminali mesenchimali umane

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

Una schermata di soppressore Deep-sequenziamento-assistita, spontanea nel lievito a fissione Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Semiconductor Sequencing for Preimplantation Genetic Testing for Aneuploidy

Sequenziamento dei semiconduttori per il test genetico preimpianto per l'aneuplodia

Chromosomal aneuploidy, one of the main causes leading to embryonic development arrest, implantation failure, or pregnancy loss, has been well documented ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequenziamento dell'mRNA da sangue intero utilizzando il sequenziamento di NanoPore

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...