Name: flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma
Uploaded: 2017-06-10T13:00:00
Description: Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

O desenvolvimento deste método de projeto foi financiado pelo Departamento de Patologia e Medicina de Laboratório da Weill Cornell Medical College. Reconhecemos o Programa de Treinamento Tri-Institucional em Biologia Computacional e Medicina para financiamento parcial. Gostaríamos de agradecer aos cientistas que compartilharam seu tempo e conhecimento conosco, especialmente Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; E todos do Weill Cornell Medical College Genomics Core Facility, incluindo Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson e Tuo Zhang.

1. Processamento e congelamento de tecidos <ol><li> Recolher o tecido dos linfonodos em solução salina tamponada com fosfato (PBS) ou no meio do Instituto Roswell Park Memorial (RPMI) e processar dentro de 24 h de coleta. Transferir o tecido ganglionar excisado 9 para uma placa de Petri contendo 10 mL de RPMI com 2% de soro de vitelo fetal (FCS) e picá-lo finamente com uma lâmina de bisturi fresca. Use a parte traseira de um êmbolo de seringa de 10 mL para moer / dissociar o tecido. </li><...

<ol>
	<li>Abrams, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=National+Cancer+Institute's+Precision+Medicine+Initiatives+for+the+new+National+Clinical+Trials+Network.">National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.</a> American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).</li><li>Gagan, J., Van Allen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+sequencing+to+guide+cancer+therapy.">Next-generation sequencing to guide cancer therapy.</a> Genome medicine. 7, 80 (2015).</li><li>Matsuki, E., Younes, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphomagenesis+in+Hodgkin+lymphoma.">Lymphomagenesis in Hodgkin lymphoma.</a> Seminars in cancer biology. 34, 14-21 (2015).</li><li>Fromm, J. R., Kussick, S. J., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+purification+of+classical+Hodgkin+cells+from+lymph+nodes+by+flow+cytometry+and+flow+cytometric+cell+sorting.">Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting.</a> Am J Clin Pathol. 126 (5), 764-780 (2006).</li><li>Fromm, J. R., Thomas, A., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+can+diagnose+classical+hodgkin+lymphoma+in+lymph+nodes+with+high+sensitivity+and+specificity.">Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity.</a> Am J Clin Pathol. 131 (3), 322-332 (2009).</li><li>Roshal, M., Wood, B. L., Fromm, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+detection+of+the+classical+hodgkin+lymphoma:+clinical+and+research+applications.">Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications.</a> Advances in hematology. 2011, 387034 (2011).</li><li>Reichel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+sorting+and+exome+sequencing+reveal+the+oncogenome+of+primary+Hodgkin+and+Reed-Sternberg+cells.">Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.</a> Blood. 125 (7), 1061-1072 (2015).</li><li>Kozarewa, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Modified+Method+for+Whole+Exome+Resequencing+from+Minimal+Amounts+of+Starting+DNA.">A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA.</a> PLoS ONE. 7 (3), e32617 (2012).</li><li>Brunicardi, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Schwartz's Principles of Surgery. , (2014).</li><li>Kantor, A. B., Roederer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+analysis+of+leukocytes.">FACS analysis of leukocytes.</a> Handbook of Experimental Immunology. 2, (1996).</li><li>Sanders, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways+of+adhesion+in+spontaneous+rosetting+of+T-lymphocytes+to+the+Hodgkin's+cell+line+L428.">Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428.</a> Cancer Res. 48 (1), 37-40 (1988).</li><li>Biosciences. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).</li><li>. Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/Q33216">https://www.thermofisher.com/order/catalog/product/Q33216</a> (2017)</li><li>Roche Nimblegen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).</li><li>Li, H., Durbin, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+accurate+short+read+alignment+with+Burrows-Wheeler+transform.">Fast and accurate short read alignment with Burrows-Wheeler transform.</a> Bioinformatics. 25 (14), 1754-1760 (2009).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Saunders, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strelka:+accurate+somatic+small-variant+calling+from+sequenced+tumor-normal+sample+pairs.">Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.</a> Bioinformatics. 28 (14), 1811-1817 (2012).</li><li>Cingolani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+program+for+annotating+and+predicting+the+effects+of+single+nucleotide+polymorphisms,+SnpEff:+SNPs+in+the+genome+of+Drosophila+melanogaster+strain+w1118;+iso-2;+iso-3.">A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.</a> Fly (Austin). 6 (2), 80-92 (2012).</li><li>Dobin, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Briefings in bioinformatics. 14 (2), 178-192 (2013).</li><li>. DNA copy number data analysis. v.R package version 1.34.0 Available from: <a target="_blank" href="https://omictools.com/dnacopy-tool">https://omictools.com/dnacopy-tool</a> (2013)</li></ol>

Futuras aplicações ou direções depois de dominar esta técnica Este trabalho permite a sequenciação exoma de amostras contendo pelo menos 10 ng de DNA. No contexto clínico, este limite exclui a maioria das amostras de aspiração com agulhas finas devido ao material insuficiente, mas inclui biópsias básicas adequadas e amostras de biópsia excisional. Isso permitirá a aquisição de dados de um conjunto maior de possíveis amostras. <st...

<html> Os avanços na genómica do câncer como resultado da sequenciação da próxima geração levaram a avanços significativos na identificação de alvos terapêuticos e na prognóstico para muitas neoplasias hematológicas e não hematológicas. Novas estratégias de tratamento individualizado baseadas em alterações genômicas específicas estão sendo introduzidas rapidamente em muitos tipos de tumores (revisado nas referências 1 , 2 ). Apesar do progresso significativo na genômica do linfoma, o genoma das células neoplásicas de HRS no linfoma de Hodgkin clássico (CHL) foi subexplorado. As investigações foram prejudicadas pela escassez de células neoplásicas de HRS dentro de um microambiente reativo, tornando difícil isolar populações de células HRS purificadas 3 . O método para isolar células HRS viáveis ​​de tumores primários foi desenvolvido por Fromm et al. 4 ,O método utiliza um cocktail de oito anticorpos, composto por CD30, CD15, CD40, CD95, CD45 CD20, CD5 e CD64, para identificar inequivocamente células HRS de uma suspensão de tumor CHL. Usando esta metodologia, nós São capazes de isolar pelo menos 1.000 células HRS viáveis ​​de suspensões celulares frescas ou congeladas de biópsias tumorais consistindo em pelo menos 10 7 células (aproximadamente 10 mg de tecido). A pureza é superior a 90% por análise citométrica de fluxo e é estimada como sendo Pelo menos 80% pela análise genômica exoma de dez casos consecutivos. Nós refinamos uma técnica de isolamento de células citométricas de fluxo que facilitou o processo, permitindo o isolamento rápido de milhares de células HRS viáveis ​​de tumores primários de CHL 7 . Utilizamos a técnica para produzir o que se acredita ser a primeira sequência de exomas inteiras das células tumorais em casos primários de linfoma de Hodgkin. Nossos estudos demonstram queE viabilidade de estudos de alto rendimento, em todo o genoma, de casos individuais de CHL e já levaram à identificação de novas alterações genômicas com o potencial de explicar aspectos da patogênese de CHL. Desenvolvemos ainda um pipeline para utilizar o DNA extraído para estudos genômicos de alto rendimento. A fim de obter resultados confiáveis ​​de cerca de 1.000 células HRS classificadas (o mínimo obtido em casos seqüenciais), desenvolvemos um procedimento de construção de biblioteca de DNA de próxima geração modificado 8 que nos permitiu aumentar a eficiência da ligação de adaptador e gerar bibliotecas de fragmentos de DNA Sem amplificação excessiva. Este método permite a análise de amostras clínicas de rotina e a detecção de mutações recorrentes e alterações cromossômicas 7 .

<table border="0" cellpadding="0" cellspacing="0" width="1576">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Petri or Cell Culture Dish (sterile)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td style="width:535px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">RPMI-1640 Media</td>
			<td>Roswell Park Memorial Institute</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal Calf Serum (FCS), (heat inactivated)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI with 2% FCS (make fresh or store for up to 1 month)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">scalpel with fresh blade</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 ml syringe (no needle)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryogenic vials</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical centrifuge tubes, force</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td>capable of handling 50 ml conical centrifuge tubes and providing 400g</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes buffer(1M, cell culture grade)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">phosphate buffered saline (PBS)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pluoronic-F68</td>
			<td style="width:352px;">Thermo-Fisher</td>
			<td style="width:119px;">24040-032</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAase-I</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">D4527-10KU</td>
			<td>store as 5mg/ml in RPMI in -200C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic &#8211;F68 (1X))</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD64-FITC (22)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD30-PE (BerH83)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD5-ECD (BL1a)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD40-PerCP-eFluor 710 (1C10)</td>
			<td style="width:352px;">Ebiosciences, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD20-PC7 (B9E9)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD15-APC (HI98)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD45 APC-H7 (2D1)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD95-Pacific Blue (DX2)</td>
			<td style="width:352px;">Life Technologies, Grand Island, NY</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD2 (5 &#956;g; clone RPA-2.10)</td>
			<td style="width:352px;">Biolegend, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD54 (10 &#956;g; clone 84H10)</td>
			<td style="width:352px;">Serotec, Oxford, United Kingdom</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD58 (10 &#956;g; clone TS2/9)</td>
			<td style="width:352px;">eBioscience, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LFA-1 (12 &#956;g; clone MHM23)</td>
			<td style="width:352px;">Novus Biologicals, Littleton, CO</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD CS&#38;T Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accudrop Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BC Versa Comp antibody capture beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>Compensation Beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD-FACS ARIA special research order instrument using 5 lasers</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Wizard</td>
			<td style="width:352px;">Promega</td>
			<td>A2360</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 mM Tris-Cl buffer</td>
			<td style="width:352px;">NA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit dsDNA HS Assay kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">S2 Sonicator</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td>Alternatives may be substituted</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">microTUBE</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low-Throughput Library Preparation Kit</td>
			<td style="width:352px;">Kapa Biosystems, Wilmington, MA</td>
			<td>KK8221</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Sybr Green</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">S9430</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Agencourt AMPure XP Beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Bioanalyzer</td>
			<td style="width:352px;">Agilent Technologies, Santa Clara, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqCap EZ Exome v.3.0</td>
			<td style="width:352px;">Roche Nimblegen</td>
			<td style="width:119px;">6465684001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">HiSeq</td>
			<td style="width:352px;">Illumina</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style Universal adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style index adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 1</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>AATGATACGGCGACCACCGAGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 2</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>CAAGCAGAAGACGGCATACGAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Nuclease Free Duplex Buffer</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD FACSDIVA software</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Falcon Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Flow Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma

As células de Hodgkin Reed-Sternberg do linfoma de Hodgkin clássico são distribuídas escassamente em um fundo de linfócitos inflamatórios e tipicamente compreendem menos de 1% da massa tumoral. O material derivado do tumor a granel contém conteúdo de tumor em uma concentração insuficiente para caracterização. Portanto, a classificação de células ativadas por fluorescência usando oito anticorpos, bem como a dispersão lateral e frontal, é descrita aqui como um método de separação e concentração rápida com milhares de células HRS de alta pureza do tumor para estudo posterior. Ao mesmo tempo, porque os protocolos padrão para o sequenciamento exoma tipicamente requerem 100-1000 ng de DNA de entrada, que muitas vezes é muito alto, mesmo com a classificação de fluxo, também fornecemos um protocolo de construção de biblioteca otimizado e de baixa entrada capaz de produzir alta qualidade Dados de até 10 ng de DNA de entrada. Esta combinação é capaz de produzir bibliotecas de próxima geração adequadas para a captura de hibridação de todo o mundoIscas xome ou painéis direcionados focados, conforme desejado. Exome seqüenciamento das células HRS, quando comparado contra células T ou B intratumor saudáveis, pode identificar alterações somáticas, incluindo mutações, inserções e deleções, e alterações no número de cópias. Essas descobertas elucidam a biologia molecular das células HRS e podem revelar vias para tratamentos medicamentosos direcionados.

Um plano de bioanalyzer deve ser tomado após a ampliação da biblioteca e a limpeza do talão de 0,8x. Deveria ver uma distribuição &quot;normal-like&quot; de tamanhos de fragmentos no intervalo desejado ( Figura 2a ). Desvios dessa forma, como um &quot;ombro&quot; visível na curva, indicam a presença de um artefato de alto ou baixo peso molecular. Por exemplo, a Figura 2b -2d mostra exemplos de biblioteca...

Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Aqui, descrevemos uma classificação de células de citometria de fluxo combinado e um protocolo de construção de bibliotecas de próxima geração, de baixa entrada, projetado para produzir dados de alta qualidade e total de exomas das células Hodgkin Reed-Sternberg (HRS) do linfoma de Hodgkin clássico (CHL).

Classificação de fluxo e sequenciação Exome das células de Reed-Sternberg do linfoma de Hodgkin clássico

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically ...

Research

JoVE Journal

Genetics

Detection of Copy Number Alterations Using Single Cell Sequencing

Detecção de Copy Number Alterações Usando Sequencing única célula

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Genética

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Análise transcriptomic de<em&gt; C</em&gt;.<em&gt; elegans</em&gt; RNA Sequenciação de dados através da Suíte Tuxedo no Projeto Galaxy

Next generation sequencing (NGS) technologies have revolutionized the nature of biological investigation. Of these, RNA Sequencing (RNA-Seq) has emerged ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: Uma alta taxa de transferência baseada no sequenciamento técnica para identificar a tarde replicando regiões do genoma

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Isolamento do DNA robusto e construção de biblioteca de sequenciamento de alto rendimento para espécimes de herbário

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Amplificação de perto completos provírus HIV-1 para a próxima geração de sequenciamento

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Identificação do elevado-throughput de sequências de genes regulatórios utilizando a próxima geração sequenciamento de conformação Circular cromossoma capturar (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Isolando, sequenciamento e análise MicroRNAs extracelular das células-tronco mesenquimais humanas

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

Uma tela de supressor de Deep-sequenciamento-assistida, espontânea na fissão levedura Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Semiconductor Sequencing for Preimplantation Genetic Testing for Aneuploidy

Sequenciamento de semicondutores para teste genético pré-implante para aneuploidia

Chromosomal aneuploidy, one of the main causes leading to embryonic development arrest, implantation failure, or pregnancy loss, has been well documented ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequenciamento de mRNA de sangue total usando sequenciamento de nanoporos

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...