Name: flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma
Uploaded: 2017-06-10T13:00:00
Description: Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

El desarrollo de este método de proyecto fue financiado por el Departamento de Patología y Medicina de Laboratorio de Weill Cornell Medical College. Reconocemos el Programa de Formación Tri-Institucional en Biología Computacional y Medicina para la financiación parcial. Quisiéramos agradecer a los científicos que compartieron su tiempo y conocimiento con nosotros, especialmente Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; Y todos los miembros de la Fundación Genómica de la Facultad de Medicina de Weill Cornell, incluyendo Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson y Tuo Zhang.

1. Tratamiento y congelación de tejidos <ol><li> Recoja el tejido de los ganglios linfáticos en solución salina tamponada con fosfato (PBS) o en el medio del Instituto Memorial de Roswell Park (RPMI) y procese dentro de las 24 horas de su recolección. Transferir el tejido 9 de ganglios linfáticos extirpados a una placa de Petri que contiene 10 ml de RPMI con 2% de suero fetal de ternera (FCS) y picar finamente con una cuchilla de bisturí fresca. Utilice la parte posterior de un émbolo de...

<ol>
	<li>Abrams, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=National+Cancer+Institute's+Precision+Medicine+Initiatives+for+the+new+National+Clinical+Trials+Network.">National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.</a> American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).</li><li>Gagan, J., Van Allen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+sequencing+to+guide+cancer+therapy.">Next-generation sequencing to guide cancer therapy.</a> Genome medicine. 7, 80 (2015).</li><li>Matsuki, E., Younes, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphomagenesis+in+Hodgkin+lymphoma.">Lymphomagenesis in Hodgkin lymphoma.</a> Seminars in cancer biology. 34, 14-21 (2015).</li><li>Fromm, J. R., Kussick, S. J., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+purification+of+classical+Hodgkin+cells+from+lymph+nodes+by+flow+cytometry+and+flow+cytometric+cell+sorting.">Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting.</a> Am J Clin Pathol. 126 (5), 764-780 (2006).</li><li>Fromm, J. R., Thomas, A., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+can+diagnose+classical+hodgkin+lymphoma+in+lymph+nodes+with+high+sensitivity+and+specificity.">Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity.</a> Am J Clin Pathol. 131 (3), 322-332 (2009).</li><li>Roshal, M., Wood, B. L., Fromm, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+detection+of+the+classical+hodgkin+lymphoma:+clinical+and+research+applications.">Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications.</a> Advances in hematology. 2011, 387034 (2011).</li><li>Reichel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+sorting+and+exome+sequencing+reveal+the+oncogenome+of+primary+Hodgkin+and+Reed-Sternberg+cells.">Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.</a> Blood. 125 (7), 1061-1072 (2015).</li><li>Kozarewa, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Modified+Method+for+Whole+Exome+Resequencing+from+Minimal+Amounts+of+Starting+DNA.">A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA.</a> PLoS ONE. 7 (3), e32617 (2012).</li><li>Brunicardi, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Schwartz's Principles of Surgery. , (2014).</li><li>Kantor, A. B., Roederer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+analysis+of+leukocytes.">FACS analysis of leukocytes.</a> Handbook of Experimental Immunology. 2, (1996).</li><li>Sanders, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways+of+adhesion+in+spontaneous+rosetting+of+T-lymphocytes+to+the+Hodgkin's+cell+line+L428.">Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428.</a> Cancer Res. 48 (1), 37-40 (1988).</li><li>Biosciences. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).</li><li>. Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/Q33216">https://www.thermofisher.com/order/catalog/product/Q33216</a> (2017)</li><li>Roche Nimblegen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).</li><li>Li, H., Durbin, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+accurate+short+read+alignment+with+Burrows-Wheeler+transform.">Fast and accurate short read alignment with Burrows-Wheeler transform.</a> Bioinformatics. 25 (14), 1754-1760 (2009).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Saunders, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strelka:+accurate+somatic+small-variant+calling+from+sequenced+tumor-normal+sample+pairs.">Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.</a> Bioinformatics. 28 (14), 1811-1817 (2012).</li><li>Cingolani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+program+for+annotating+and+predicting+the+effects+of+single+nucleotide+polymorphisms,+SnpEff:+SNPs+in+the+genome+of+Drosophila+melanogaster+strain+w1118;+iso-2;+iso-3.">A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.</a> Fly (Austin). 6 (2), 80-92 (2012).</li><li>Dobin, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Briefings in bioinformatics. 14 (2), 178-192 (2013).</li><li>. DNA copy number data analysis. v.R package version 1.34.0 Available from: <a target="_blank" href="https://omictools.com/dnacopy-tool">https://omictools.com/dnacopy-tool</a> (2013)</li></ol>

Aplicaciones o direcciones futuras después de dominar esta técnica Este trabajo permite la secuenciación exome de muestras que contienen al menos 10 ng de ADN. En el contexto clínico, este límite excluye la mayoría de las muestras de aspiración con aguja fina debido a un material insuficiente, pero incluye biopsias de núcleo adecuadas y muestras de biopsia por escisión. Esto permitirá la adquisición de datos de un conjunto más grande de posibles muestras. <p ...

<html> Los avances en genómica del cáncer como resultado de la próxima generación de secuenciación han llevado a avances significativos en la identificación de objetivos terapéuticos y en el pronóstico de muchas neoplasias hematológicas y no hematológicas. Se están introduciendo rápidamente nuevas estrategias de tratamiento individualizadas basadas en alteraciones genómicas específicas en muchos tipos de tumores (revisadas en las referencias 1 , 2 ). A pesar de los avances significativos en la genómica del linfoma, el genoma de las células HRS neoplásicas en el linfoma de Hodgkin clásico (CHL) había sido subexplorado. Las investigaciones se han visto obstaculizadas por la escasez de células HRS neoplásicas dentro de un microambiente reactivo, lo que dificulta el aislamiento de células purificadas HRS poblaciones [ 3] . El método para aislar células HRS viables de tumores primarios fue desarrollado por Fromm et al. 4 ,El método utiliza un cóctel de ocho anticuerpos, que consta de CD30, CD15, CD40, CD95, CD45 CD20, CD5 y CD64, para identificar inequívocamente células HRS a partir de una suspensión tumoral CHL. Son capaces de aislar al menos 1.000 células HRS viables de suspensiones de células frescas o congeladas a partir de biopsias tumorales que consisten en al menos 10 ^ { 7 } células (aproximadamente 10 mg de tejido). La pureza es superior al 90% mediante análisis citométrico de flujo y se estima que es Al menos 80% por exome análisis genómico de diez casos consecutivos. Hemos refinado una técnica de aislamiento de células de citometría de flujo que ha facilitado enormemente el proceso, lo que permite el rápido aislamiento de miles de células HRS viables de los tumores primarios CHL [ 7] . Hemos utilizado la técnica para producir lo que se cree que es la primera secuencia de todo el exome de las células tumorales en los casos primarios de linfoma de Hodgkin. Nuestros estudios demuestranE viabilidad de alto rendimiento, el genoma de los estudios de los casos individuales CHL y ya han llevado a la identificación de nuevas alteraciones genómicas con el potencial de explicar los aspectos de la patogénesis CHL. Desarrollamos una tubería para utilizar el ADN extraído para estudios genómicos de alto rendimiento. Con el fin de obtener resultados fiables de tan sólo 1.000 células HRS clasificadas (el mínimo obtenido a partir de casos secuenciales), hemos desarrollado un procedimiento modificado de construcción de biblioteca de ADN de próxima generación 8 que nos permitió aumentar la eficiencia de ligadura adaptador y generar bibliotecas de fragmentos de ADN Sin amplificación excesiva. Este método permite el análisis de muestras clínicas de rutina y la detección de mutaciones recurrentes y alteraciones cromosómicas 7 .

<table border="0" cellpadding="0" cellspacing="0" width="1576">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Petri or Cell Culture Dish (sterile)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td style="width:535px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">RPMI-1640 Media</td>
			<td>Roswell Park Memorial Institute</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal Calf Serum (FCS), (heat inactivated)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI with 2% FCS (make fresh or store for up to 1 month)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">scalpel with fresh blade</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 ml syringe (no needle)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryogenic vials</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical centrifuge tubes, force</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td>capable of handling 50 ml conical centrifuge tubes and providing 400g</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes buffer(1M, cell culture grade)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">phosphate buffered saline (PBS)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pluoronic-F68</td>
			<td style="width:352px;">Thermo-Fisher</td>
			<td style="width:119px;">24040-032</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAase-I</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">D4527-10KU</td>
			<td>store as 5mg/ml in RPMI in -200C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic &#8211;F68 (1X))</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD64-FITC (22)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD30-PE (BerH83)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD5-ECD (BL1a)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD40-PerCP-eFluor 710 (1C10)</td>
			<td style="width:352px;">Ebiosciences, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD20-PC7 (B9E9)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD15-APC (HI98)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD45 APC-H7 (2D1)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD95-Pacific Blue (DX2)</td>
			<td style="width:352px;">Life Technologies, Grand Island, NY</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD2 (5 &#956;g; clone RPA-2.10)</td>
			<td style="width:352px;">Biolegend, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD54 (10 &#956;g; clone 84H10)</td>
			<td style="width:352px;">Serotec, Oxford, United Kingdom</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD58 (10 &#956;g; clone TS2/9)</td>
			<td style="width:352px;">eBioscience, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LFA-1 (12 &#956;g; clone MHM23)</td>
			<td style="width:352px;">Novus Biologicals, Littleton, CO</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD CS&#38;T Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accudrop Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BC Versa Comp antibody capture beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>Compensation Beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD-FACS ARIA special research order instrument using 5 lasers</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Wizard</td>
			<td style="width:352px;">Promega</td>
			<td>A2360</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 mM Tris-Cl buffer</td>
			<td style="width:352px;">NA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit dsDNA HS Assay kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">S2 Sonicator</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td>Alternatives may be substituted</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">microTUBE</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low-Throughput Library Preparation Kit</td>
			<td style="width:352px;">Kapa Biosystems, Wilmington, MA</td>
			<td>KK8221</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Sybr Green</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">S9430</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Agencourt AMPure XP Beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Bioanalyzer</td>
			<td style="width:352px;">Agilent Technologies, Santa Clara, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqCap EZ Exome v.3.0</td>
			<td style="width:352px;">Roche Nimblegen</td>
			<td style="width:119px;">6465684001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">HiSeq</td>
			<td style="width:352px;">Illumina</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style Universal adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style index adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 1</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>AATGATACGGCGACCACCGAGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 2</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>CAAGCAGAAGACGGCATACGAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Nuclease Free Duplex Buffer</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD FACSDIVA software</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Falcon Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Flow Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma

Las células de Hodgkin Reed-Sternberg del linfoma de Hodgkin clásico se distribuyen escasamente dentro de un fondo de linfocitos inflamatorios y típicamente comprenden menos del 1% de la masa tumoral. El material derivado del tumor a granel contiene contenido de tumor a una concentración insuficiente para la caracterización. Por lo tanto, la clasificación de células activadas por fluorescencia utilizando ocho anticuerpos, así como la dispersión lateral y hacia adelante, se describe aquí como un método de separación y concentración rápidas con miles de células HRS de alta pureza del tumor para estudio posterior. Al mismo tiempo, debido a que los protocolos estándar para la secuenciación de exome típicamente requieren 100-1,000 ng de ADN de entrada, que a menudo es demasiado alto, incluso con clasificación de flujo, también proporcionamos un protocolo optimizado de construcción de biblioteca de entrada baja capaz de producir alta calidad Datos de tan poco como 10 ng de ADN de entrada. Esta combinación es capaz de producir bibliotecas de próxima generación adecuadas para la captura de hibridación de todo-eXome o más enfocados paneles de destino, como se desee. La secuenciación exome de las células HRS, cuando se compara con células T o B intratumor sanas, puede identificar alteraciones somáticas, incluyendo mutaciones, inserciones y deleciones, y alteraciones del número de copias. Estos hallazgos aclaran la biología molecular de las células HRS y pueden revelar vías para los tratamientos de fármacos dirigidos.

Se debe tomar un diagrama de bioanalizador después de la amplificación de la biblioteca y limpieza de gránulos de 0,8x. Uno debería ver una distribución &quot;normal-como&quot; de tamaños de fragmento en el rango deseado ( Figura 2a ]. Las desviaciones de esta forma, tales como un &quot;hombro&quot; visible en la curva, indican la presencia de un artefacto de alto o bajo peso molecular. Por ejemplo, la Figura 2b- 2...

Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

En este trabajo describimos una clasificación combinada de células de citometría de flujo y un protocolo de construcción de biblioteca de próxima generación, de bajo ingreso, diseñado para producir datos de exome de alta calidad de las células Hodgkin Reed-Sternberg (HRS) del linfoma de Hodgkin clásico (CHL).

Clasificación de flujo y secuenciación exome de las células Reed-Sternberg del linfoma de Hodgkin clásico

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically ...

Research

JoVE Journal

Genetics

Detection of Copy Number Alterations Using Single Cell Sequencing

Detección del número de copias alteraciones Uso de Secuenciación de los organismos unicelulares

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Investigación

Genética

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Análisis de transcriptómica<em&gt; C</em&gt;.<em&gt; elegans</em&gt; ARN secuencia de datos a través de la suite smoking en el Proyecto Galaxy

Next generation sequencing (NGS) technologies have revolutionized the nature of biological investigation. Of these, RNA Sequencing (RNA-Seq) has emerged ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: Una alto rendimiento basado en la secuencia técnica para identificar replicación tardía de regiones del genoma

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Robusto de ADN y la secuenciación de alto rendimiento biblioteca construcción de especímenes de herbario

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Amplificación de cerca integrales provirus VIH-1 para secuenciación de próxima generación

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Captura de alto rendimiento identificación de secuencias reguladoras de genes utilizando secuenciación de próxima generación de conformación Circular cromosoma (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Aislamiento, secuenciación y análisis de microRNA extracelular de las células madre mesenquimales humanas

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

Una pantalla de supresor asistida por secuenciación profunda, espontánea en la levadura de fisión Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Semiconductor Sequencing for Preimplantation Genetic Testing for Aneuploidy

Secuenciación de semiconductores para pruebas genéticas preimplantaciones para la aneuploidía

Chromosomal aneuploidy, one of the main causes leading to embryonic development arrest, implantation failure, or pregnancy loss, has been well documented ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Secuenciación de ARNm de sangre entera utilizando secuenciación de nanoporos

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...