Name: flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma
Uploaded: 2017-06-10T13:00:00
Description: Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Utvecklingen av denna projektmetod finansierades av Institutionen för patologi och laboratoriemedicin vid Weill Cornell Medical College. Vi erkänner det tri-institutionella utbildningsprogrammet i beräkningsbiologi och medicin för delfinansiering. Vi vill tacka forskarna som delade sin tid och sin kunskap med oss, särskilt Maryke Appel; Dan Burgess; Iwanka Kozarewa; Tchad Locklear; Och alla från Weill Cornell Medical College Genomics Core Facility, inklusive Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson och Tuo Zhang.

1. Vävnadsbehandling och frysning <ol><li> Samla lymfkörtelvävnad i fosfatbuffrad saltlösning (PBS) eller Roswell Park Memorial Institute medium (RPMI) och bearbeta inom 24 h samling. Överför utklippt lymfkörtelvävnad 9 till en petriskål innehållande 10 ml RPMI med 2% fetalt kalvserum (FCS) och finhackat det med ett nytt skalpellblad. Använd baksidan av en 10 ml sprutskolv för att ytterligare slipa / dissociera vävnaden. </li><li> Överför vätskan till ett 50 ml koniskt rör geno...

<ol>
	<li>Abrams, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=National+Cancer+Institute's+Precision+Medicine+Initiatives+for+the+new+National+Clinical+Trials+Network.">National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.</a> American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).</li><li>Gagan, J., Van Allen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+sequencing+to+guide+cancer+therapy.">Next-generation sequencing to guide cancer therapy.</a> Genome medicine. 7, 80 (2015).</li><li>Matsuki, E., Younes, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphomagenesis+in+Hodgkin+lymphoma.">Lymphomagenesis in Hodgkin lymphoma.</a> Seminars in cancer biology. 34, 14-21 (2015).</li><li>Fromm, J. R., Kussick, S. J., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+purification+of+classical+Hodgkin+cells+from+lymph+nodes+by+flow+cytometry+and+flow+cytometric+cell+sorting.">Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting.</a> Am J Clin Pathol. 126 (5), 764-780 (2006).</li><li>Fromm, J. R., Thomas, A., Wood, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+can+diagnose+classical+hodgkin+lymphoma+in+lymph+nodes+with+high+sensitivity+and+specificity.">Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity.</a> Am J Clin Pathol. 131 (3), 322-332 (2009).</li><li>Roshal, M., Wood, B. L., Fromm, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometric+detection+of+the+classical+hodgkin+lymphoma:+clinical+and+research+applications.">Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications.</a> Advances in hematology. 2011, 387034 (2011).</li><li>Reichel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+sorting+and+exome+sequencing+reveal+the+oncogenome+of+primary+Hodgkin+and+Reed-Sternberg+cells.">Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.</a> Blood. 125 (7), 1061-1072 (2015).</li><li>Kozarewa, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Modified+Method+for+Whole+Exome+Resequencing+from+Minimal+Amounts+of+Starting+DNA.">A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA.</a> PLoS ONE. 7 (3), e32617 (2012).</li><li>Brunicardi, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Schwartz's Principles of Surgery. , (2014).</li><li>Kantor, A. B., Roederer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+analysis+of+leukocytes.">FACS analysis of leukocytes.</a> Handbook of Experimental Immunology. 2, (1996).</li><li>Sanders, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+pathways+of+adhesion+in+spontaneous+rosetting+of+T-lymphocytes+to+the+Hodgkin's+cell+line+L428.">Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428.</a> Cancer Res. 48 (1), 37-40 (1988).</li><li>Biosciences. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).</li><li>. Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: <a target="_blank" href="https://www.thermofisher.com/order/catalog/product/Q33216">https://www.thermofisher.com/order/catalog/product/Q33216</a> (2017)</li><li>Roche Nimblegen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).</li><li>Li, H., Durbin, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+accurate+short+read+alignment+with+Burrows-Wheeler+transform.">Fast and accurate short read alignment with Burrows-Wheeler transform.</a> Bioinformatics. 25 (14), 1754-1760 (2009).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Saunders, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strelka:+accurate+somatic+small-variant+calling+from+sequenced+tumor-normal+sample+pairs.">Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs.</a> Bioinformatics. 28 (14), 1811-1817 (2012).</li><li>Cingolani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+program+for+annotating+and+predicting+the+effects+of+single+nucleotide+polymorphisms,+SnpEff:+SNPs+in+the+genome+of+Drosophila+melanogaster+strain+w1118;+iso-2;+iso-3.">A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.</a> Fly (Austin). 6 (2), 80-92 (2012).</li><li>Dobin, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+Genomics+Viewer+(IGV):+high-performance+genomics+data+visualization+and+exploration.">Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration.</a> Briefings in bioinformatics. 14 (2), 178-192 (2013).</li><li>. DNA copy number data analysis. v.R package version 1.34.0 Available from: <a target="_blank" href="https://omictools.com/dnacopy-tool">https://omictools.com/dnacopy-tool</a> (2013)</li></ol>

Framtida applikationer eller anvisningar efter att ha behärskat denna teknik Detta arbete möjliggör exome-sekvensering från prover innehållande minst 10 ng DNA. I det kliniska sammanhanget utesluter denna gräns de flesta finna-aspirationsprover på grund av otillräckligt material, men det innefattar adekvata kärnbiopsier och excisionsbiopsiprover. Detta kommer att möjliggöra förvärv av data från en större uppsättning möjliga prover. <p class="jove_content...

<html> Framsteg i cancergenom som ett resultat av nästa generations sekvensering har lett till betydande genombrott vid identifieringen av terapeutiska mål och i prognostikering för många hematologiska och icke-hematologiska neoplasmer. Nya individuella behandlingsstrategier baserade på specifika genomförändringar introduceras snabbt i många tumortyper (ses i referenser 1 , 2 ). Trots betydande framsteg i lymfom genomik hade genomet hos neoplastiska HRS-celler i klassiskt Hodgkin-lymfom (CHL) undersökts. Undersökningarna har hindrats av brist på neoplastiska HRS-celler inom en reaktiv mikromiljö, vilket gör det svårt att isolera renade HRS-cellpopulationer 3 . Metoden för isolering av livskraftiga HRS-celler från primära tumörer utvecklades av Fromm et al. 4 ,Ref &quot;&gt; 5 , 6. Metoden använder en åtta antikroppscocktail, bestående av CD30, CD15, CD40, CD95, CD45 CD20, CD5 och CD64 för att entydigt identifiera HRS-celler från en CHL-tumorsuspension. Kan isolera minst 1000 livskraftiga HRS-celler från friska eller frysta cellsuspensioner från tumörbiopsier som består av minst 10 7 celler (cirka 10 mg vävnad). Renheten är större än 90% genom flödescytometrisk analys och uppskattas vara Minst 80% genom genom-genom-analys av tio på varandra följande fall. Vi har förfinat en flödescytometrisk cellisoleringsteknik som kraftigt underlättat processen, vilket möjliggör snabb isolering av tusentals livskraftiga HRS-celler från primära CHL-tumörer 7 . Vi har använt tekniken för att producera vad som anses vara den första hel-exom-sekvensen av tumörcellerna i primära fall av Hodgkin-lymfom. Våra studier visar attE genomförbarhet av hög genomströmning genom genomgående studier av enskilda CHL-fall och har redan lett till identifiering av nya genomiska förändringar med potential att förklara aspekter av CHL-patogenes. Vi vidareutvecklade en pipeline för att utnyttja det extraherade DNA-materialet för genom genomgångna genomströmningsstudier. För att uppnå tillförlitliga resultat från så få som 1000 sorterade HRS-celler (det minsta som erhölls från sekventiella fall) utvecklade vi vidare en modifierad nästa generations DNA-biblioteksbyggnadsprocedur 8 som gjorde det möjligt för oss att öka adapterligeringseffektiviteten och att generera DNA-fragmentbibliotek Utan överdriven amplifiering. Denna metod möjliggör analys av rutinmässiga kliniska prover och detektering av återkommande mutationer och kromosomala förändringar 7 .

<table border="0" cellpadding="0" cellspacing="0" width="1576">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Petri or Cell Culture Dish (sterile)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td style="width:535px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">RPMI-1640 Media</td>
			<td>Roswell Park Memorial Institute</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fetal Calf Serum (FCS), (heat inactivated)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RPMI with 2% FCS (make fresh or store for up to 1 month)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">scalpel with fresh blade</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 ml syringe (no needle)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cryogenic vials</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">50 ml conical centrifuge tubes, force</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td>capable of handling 50 ml conical centrifuge tubes and providing 400g</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes buffer(1M, cell culture grade)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">phosphate buffered saline (PBS)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pluoronic-F68</td>
			<td style="width:352px;">Thermo-Fisher</td>
			<td style="width:119px;">24040-032</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAase-I</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">D4527-10KU</td>
			<td>store as 5mg/ml in RPMI in -200C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic &#8211;F68 (1X))</td>
			<td style="width:352px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD64-FITC (22)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD30-PE (BerH83)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD5-ECD (BL1a)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD40-PerCP-eFluor 710 (1C10)</td>
			<td style="width:352px;">Ebiosciences, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD20-PC7 (B9E9)</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>10 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD15-APC (HI98)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>20 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD45 APC-H7 (2D1)</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD95-Pacific Blue (DX2)</td>
			<td style="width:352px;">Life Technologies, Grand Island, NY</td>
			<td style="width:119px;"></td>
			<td>5 uL suggested starting volume; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">CD2 (5 &#956;g; clone RPA-2.10)</td>
			<td style="width:352px;">Biolegend, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD54 (10 &#956;g; clone 84H10)</td>
			<td style="width:352px;">Serotec, Oxford, United Kingdom</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD58 (10 &#956;g; clone TS2/9)</td>
			<td style="width:352px;">eBioscience, San Diego, CA</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LFA-1 (12 &#956;g; clone MHM23)</td>
			<td style="width:352px;">Novus Biologicals, Littleton, CO</td>
			<td style="width:119px;"></td>
			<td>For optional protocol; Titering is suggested</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD CS&#38;T Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD Accudrop Beads</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BC Versa Comp antibody capture beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td>Compensation Beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD-FACS ARIA special research order instrument using 5 lasers</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td>any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Wizard</td>
			<td style="width:352px;">Promega</td>
			<td>A2360</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10 mM Tris-Cl buffer</td>
			<td style="width:352px;">NA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Qubit dsDNA HS Assay kit</td>
			<td>Life Technologies, Carlsbad, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">S2 Sonicator</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td>Alternatives may be substituted</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">microTUBE</td>
			<td style="width:352px;">Covaris, Woburn, MA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low-Throughput Library Preparation Kit</td>
			<td style="width:352px;">Kapa Biosystems, Wilmington, MA</td>
			<td>KK8221</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Sybr Green</td>
			<td style="width:352px;">Sigma-Aldrich, St. Louis, MO</td>
			<td style="width:119px;">S9430</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Agencourt AMPure XP Beads</td>
			<td style="width:352px;">Beckman Coulter, Miami, FL</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Bioanalyzer</td>
			<td style="width:352px;">Agilent Technologies, Santa Clara, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SeqCap EZ Exome v.3.0</td>
			<td style="width:352px;">Roche Nimblegen</td>
			<td style="width:119px;">6465684001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">HiSeq</td>
			<td style="width:352px;">Illumina</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style Universal adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style index adapter</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 1</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>AATGATACGGCGACCACCGAGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">TruSeq-style PCR primer 2</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td>CAAGCAGAAGACGGCATACGAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">Nuclease Free Duplex Buffer</td>
			<td style="width:352px;">Integrated DNA Technologies (IDT), Coralville, Iowa</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD FACSDIVA software</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Falcon Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:571px;">BD Flow Tubes</td>
			<td style="width:352px;">BD Biosciences, San Jose, CA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

flow-sorting and exome sequencing of the reed-sternberg cells of classical hodgkin lymphoma

Hodgkin Reed-Sternberg-cellerna av klassiskt Hodgkin-lymfom fördelas sparsamt inom en bakgrund av inflammatoriska lymfocyter och innefattar typiskt mindre än 1% av tumörmassan. Material som härrör från bulktumör innehåller tumörinnehåll vid en koncentration som inte är tillräcklig för karakterisering. Därför beskrivs fluorescensaktiverad cellsortering med användning av åtta antikroppar, såväl som sido- och framåtskridande, som ett förfarande för att snabbt separera och koncentrera sig med hög renhet tusentals HRS-celler från tumören för efterföljande studie. Samtidigt, eftersom standardprotokoll för exome-sekvensering vanligtvis kräver 100-1 000 ng ingångsd DNA, vilket ofta är för högt, även med flödessortering, tillhandahåller vi också ett optimerat bibliotek med låg ingångsbibliotek som kan producera högkvalitativ Data från så lite som 10 ng ingångsd DNA. Denna kombination kan producera nästa generations bibliotek som är lämpliga för hybridiseringsinspelning av hel-eXome beten eller mer fokuserade riktade paneler, efter önskemål. Exome-sekvensering av HRS-cellerna, jämfört med friska intratumor T- eller B-celler, kan identifiera somatiska förändringar, inklusive mutationer, insertioner och deletioner och kopieringstaländringar. Dessa resultat belyser molekylärbiologin hos HRS-celler och kan avslöja vägar för riktade läkemedelsbehandlingar.

En bioanalysatorplot ska tas efter bibliotekets förstärkning och 0,8x pärluppsättning. Man bör se en &quot;normalliknande&quot; fördelning av fragmentstorlekar i det önskade området ( Figur 2a ). Avvikelser från denna form, såsom en synlig &quot;axel&quot; i kurvan, indikerar närvaron av en artefakt med hög eller låg molekylvikt. Exempelvis visar figur 2b -2d exempel på bibliotek s...

Watch this Scientific Journal Video about Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma at JoVE.com

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Här beskriver vi ett kombinerat flödescytometriskt cellsorteringssystem och ett lågpresenterat, nästa generations bibliotekskonstruktionsprotokoll som är utformat för att producera högkvalitativa, hel-exome data från Hodgkin Reed-Sternberg (HRS) -cellerna av klassiskt Hodgkin-lymfom (CHL).

Flödessortering och Exome-sekvensering av Reed-Sternberg-cellerna av klassisk Hodgkin-lymfom

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically ...

Research

JoVE Journal

Genetics

Detection of Copy Number Alterations Using Single Cell Sequencing

Detektion av Copy Number Ändringar Använda Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analysis of C. elegans RNA Sequencing Data Through the Tuxedo Suite on the Galaxy Project

Transcriptomic Analys av<em&gt; C</em&gt;.<em&gt; elegans</em&gt; RNA Sequencing data via Tuxedo Suite på Galaxy Project

Next generation sequencing (NGS) technologies have revolutionized the nature of biological investigation. Of these, RNA Sequencing (RNA-Seq) has emerged ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

G2-seq: En hög genomströmning sekvensering-baserad teknik för att identifiera sent replikera regioner i genomet

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Robust DNA isolering och hög genomströmning sekvensering bibliotek konstruktion för herbarieexemplar

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Förstärkning av nära fullängds HIV-1 Proviruses för nästa generations sekvensering

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Hög genomströmning identifiering av reglerande gensekvenser som använder nästa generations sekvensering av cirkulär kromosom konformation fånga (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Isolera, sekvensering och analysera extracellulära mikroRNA från humana mesenkymala stamceller

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

En djup-sekvensering-assisted, spontana Suppressor skärm i den Fission jäst Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Semiconductor Sequencing for Preimplantation Genetic Testing for Aneuploidy

Halvledar sekvensering för preimplantatorisk genetisk testning för aneuploidi

Chromosomal aneuploidy, one of the main causes leading to embryonic development arrest, implantation failure, or pregnancy loss, has been well documented ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sekvensering av mRNA från helblod med Nanopore sekvensering

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...