Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

الكتاب أشكر Izon العلوم المحدودة لدعمهم. وأيد هذا العمل من قبل المفوضية الأوروبية للأبحاث (PCIG11-GA-2012-321836 Nano4Bio).

1. جعل الفوسفات مخزنة المالحة مع توين-20 (PBST) العازلة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> حل واحد PBS قرص (0.01 عازلة M الفوسفات، 0.0027 M كلوريد البوتاسيوم، 0.137 M كلوريد الصوديوم، ودرجة الحموضة 7.4) في 200 مل من الماء منزوع الأيونات (18.2 MΩ سم). </li><li style=";text-align:right;direction:rtl"...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

<html> حساب لإمكانات زيتا استخدام طريقة تستند معايرة المتعلقة بالعمل التي كتبها Arjmandi وآخرون. 21. مدة النبات من الجزيئات لأنها تعبر يقاس على ثقب النانو بوصفها وظيفة من الجهد التطبيقية، وذلك باستخدام متوسط ​​الكهربائية السرعات الميدانية والجسيمات على كامل ال?...

النانوية Functionalized تزداد شعبية كما أجهزة الاستشعار في كل المجالات الطبية والبيئية. القدرة على تغيير كيمياء سطح جسيمات متناهية الصغر، ومع الحمض النووي، على سبيل المثال، تثبت مفيدة لأنظمة توصيل الدواء المستهدف 1، ورصد تفاعلات الحمض النووي والبروتينات 2-4. خاصية جسيمات متناهية الصغر شائعة بشكل متزايد يجري استخدامها في اختبارات بيولوجية وفي تقديم العلاجات غير superparamagnetism 5. الجسيمات مغنطيسية مسايرة فائقة superparamagnetic (SPPS) مفيدة للغاية في تحديد وإزالة التحاليل محددة من مخاليط معقدة ويمكن أن تفعل ذلك مع الاستخدام البسيط للمغناطيس واحد. إزالة مرة واحدة، والجسيمات ملزمة تحليلها يمكن وصفها وتحليلها يصلح للغرض. وتشمل الطرق السابقة المستخدمة للكشف وتوصيف الجسيمات النانوية التقنيات البصرية مثل تشتت الضوء الحيوي (DLS)، والمعروف باسم التحليل الطيفي الفوتون الارتباط. على الرغم من أن مرحباغ التقنية الإنتاجية، DLS يقتصر على كونه الطريقة القائمة على المتوسط وعند تحليل عينات متعددة الوسائط بدون إضافة برنامج متخصص، فإن الجزيئات الكبيرة تنتج إشارة أكثر هيمنة من ذلك بكثير، وترك بعض من جسيمات أصغر دون أن يلاحظها أحد تماما 6،7. الجسيمات التي الجسيمات تقنيات توصيف وبالتالي أكثر ملاءمة لتحليل جسيمات متناهية الصغر وأنظمة جسيمات متناهية الصغر functionalized. وتعتمد التكنولوجيات القائمة RPS حول تطبيق حقل كهربائي على عينة ومراقبة آلية نقل الجزيئات من خلال ثقب النانو الاصطناعية أو البيولوجي. وكشف جسيمات متناهية الصغر وتوصيف تقنية حديثة نسبيا استنادا RPS هو مقاوم الانضباطي نبض الاستشعار (TRPS) 8-16. TRPS هو نظام ثنائي القطب مفصولة، غشاء المسام الانضباطي من اللدائن المرنة. يسمح طريقة الانضباطي المسام للالتحاليل مجموعة من شكل 17 و حجم المراد قياسها عن طريق العابرة لهاآليات الميناء من خلال المسام. وقد سبق أن استخدمت المسام الانضباطي للكشف عن الجسيمات الصغيرة (70-95 قطرها نانومتر) تحقيق نتائج مماثلة لغيرها من التقنيات مثل التحليل الطيفي انتقال الإلكترون (تيم) 10. عندما يتم تطبيق حقل كهربائي، لوحظ حدوث تيار الأيونية وبمرور الجزيئات / الجزيئات من خلال المسام، ومنع مؤقتا المسام، مما تسبب في انخفاض الحالية التي يمكن تعريفها بأنها &quot;حدث الحصار&quot;. كل حدث الحصار هو ممثل جسيم واحد بحيث أن كل الجسيمات في عينة يمكن وصفها على أساس فردي على حجم الحصار، Δ <img alt="المعادلة 1" src="/files/ftp_upload/54577/54577eq1.jpg" /> ، والعرض الكامل نصف كحد أقصى، FWHM، فضلا عن غيرها من الخصائص الحصار. تحليل الجزيئات الفردية لأنها تمر من خلال ثقب النانو هو مفيد للعينات متعددة الوسائط كما TRPS يمكن بنجاح وفعالية يميز مجموعة من الجسيمات أحجام آمونGST عينة واحدة. الانضباطي الاستشعار نبض مقاوم يكمل حجم 10، زيتا المحتملة 12،18 وتركيز 15 القياسات في وقت واحد في شوط واحد، وبالتالي لا تزال تفرق عينات من ما شابه ذلك، إن لم يكن بنفس الحجم من قبل المسؤول سطحها 19. ميزة على تقنيات التحجيم بديلة. ويعرف إمكانات زيتا كما إمكانات الكهربائي في الطائرة من القص 20، وتحتسب من سرعات الجسيمات لأنها تعبر مسام (19). قياسات المحتملة زيتا من الجزيئات الفردية مما يعطي نظرة ثاقبة على آليات النبات وسلوك النظم جسيمات متناهية الصغر في حل، معلومات قيمة لمستقبل تصاميم جسيمات متناهية الصغر فحص لمجموعة من التطبيقات. الجسيمات التي الجسيمات تحليل من هذا النوع يسمح أيضا لانتشار وتوزيع القيم المحتملة زيتا بين عينة من السكان من يكتشفها، والسماح لمزيد من المعلومات سحركية التفاعل ن (واحد الذين تقطعت بهم السبل على الحمض النووي المزدوج تقطعت بهم السبل، على سبيل المثال) وبثبات الجسيمات في الحل التي ينبغي تحقيقها. هنا، نحن تصف تقنية يكتشف ويميز كل السطوح SPP معدلة وتعديل الحمض النووي. بروتوكول الموصوفة هنا ينطبق على مجموعة من الجسيمات النانوية غير العضوية والبيولوجية، ولكن علينا أن نظهر الإجراء باستخدام أسطح تعديل الحمض النووي نظرا لمداها واسعة من التطبيقات. تقنية تسمح للمستخدم للتمييز بين الأهداف الحمض النووي المفرد الذين تقطعت بهم السبل وتقطعت بهم السبل مزدوجة على سطح جسيمات متناهية الصغر، استنادا إلى سرعات الجسيمات النبات من خلال نظام المسام وبالتالي إمكاناتها زيتا.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

تقنيات ثقب النانو، والمعروفة ب مجسات نبض مقاوم (RPS)، وتستخدم لكشف وتحديد وتوصيف البروتينات والجزيئات والجسيمات النانوية. الاستشعار عن الانضباطي مقاوم النبض (TRPS) هو التكيف حديث نسبيا إلى RPS أن يشتمل على المسام الانضباطي التي يمكن تغييرها في الوقت الحقيقي. هنا، ونحن نستخدم TRPS لمراقبة مرات النبات النانوية المعدلة الحمض النووي لأنها تعبر الغشاء مسام الانضباطي بوصفها وظيفة من تركيز الحمض النووي والهيكل (أي، واحد الذين تقطعت بهم السبل على الحمض النووي المزدوج تقطعت بهم السبل). ويستند TRPS على قطبين حج / أجكل، مفصولة غشاء المسام من اللدائن المرنة التي تؤسس تيار الأيونية مستقر على حقل كهربائي التطبيقية. وخلافا لمختلف التكنولوجيات الجسيمات توصيف مقرها البصرية، ويمكن TRPS تميز الجزيئات الفردية بين عينة من السكان، مما يسمح للعينات متعددة الوسائط ليتم تحليلها بكل سهولة. هنا، علينا أن نظهر القياسات المحتملة زيتاعبر سرعات الجسيمات النبات من المعايير المعروفة وتطبيق هذه لعينة مرات النبات تحليلها، مما أدى إلى قياس زيتا المحتملة من تلك التحاليل. وكذلك اكتساب القيم المحتملة زيتا متوسط، يتم قياس جميع العينات باستخدام منظور الجسيمات التي الجسيمات واظهار مزيد من المعلومات على عينة معينة من خلال توزيعات السكان عينة، على سبيل المثال. هذا، يوضح هذه الطريقة إمكانية ضمن تطبيقات الاستشعار عن كل من المجالات الطبية والبيئية.

<img alt="شكل 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> الشكل 1. تمثيل تخطيطي لعمليات تنقية المغناطيسي وقياس TRPS. أ) مثال لتنقية المغناطيسية للعينة بدءا من عينة تحتوي على فائض، غير منضم القبض على التحقيق الحمض النووي. ب) TRPS سبيل المثال قياس...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

نحن هنا استخدام ثقب النانو البولي الانضباطي دمجها في تقنية الاستشعار عن نبض مقاوم للتميز الكيمياء السطحية النانوية عن طريق قياس سرعات الجسيمات النبات، والتي يمكن استخدامها لتحديد إمكانات زيتا من الجسيمات النانوية الفردية.

تقرير زيتا المحتملة عبر جسيمات متناهية الصغر إزفاء السرعات من خلال الانضباطي ثقب النانو: استخدام الجسيمات المعدلة الحمض النووي كمثال

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

The overall goal of this procedure is to characterize the surface chemistry of nano particles using tunable resistant post sensing, or TRPS, and determine the zeta potential of the material. This is demonstrating by characterizing DNA modified nano particles. This method can help answer key questions in the characterization of nanomaterials and the development of bioassay.The main advantage of this technique is that you can complete particle by particle analysis. Each DNA particle signal is translated into a zeta potential measurement, providing a complete picture of the sample being analyzed. The oldest method could provide insight into the characterization of materials.It can also be applied to other applications, such as the development of bioassay for the detection of cells, viruses, DNA, and proteins. Generally, individual new to this method will struggle because it's not a simple inject the samp and then wait for the answer. There is some input from the scientist needed.To begin this procedure, vortex streptavidin coated particles for 30 seconds before sonication for two minutes at 80 watts to assure mono dispersity. Dilute the streptavidin coated particles one in one hundred in PBST buffer to achieve a resulting concentration of one times ten to the nine particles per milliliter. Then vortex the particles for 30 seconds.Based on a binding capacity of 4, 352 picomols per milligram at the appropriate concentration of DNA to the particles for resulting concentrations of 10, 20, 30, 40, 47, 95, 140, and 210 nanomolar. After vortexing the samples for 10 seconds, place them on a rotary wheel at room temperature for 30 minutes to allow the DNA to bind to the particle surfaces via a streptavidin biotin interaction. Once the captured DNA has been added and incubated with the particles, remove the excess DNA and solution via magnetic separation by placing the samples onto a magnetic rack for 30 minutes.Following this, remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. Now add the required amount of target DNA to each sample to ensure the maximum possible target binding was reached.Vortex the samples for 10 seconds. And place them on the rotary wheel at room temperature for 30 minutes. Once the hybridization is complete, remove the excess target DNA via magnetic separation by placing the samples onto the magnetic rack for 30 minutes.Next remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. After repeating the previous steps for duplicate samples, place the samples on the rotary wheel at room temperature for 16 hours to investigate DNA hybridization times.At this point, plug in a TRPS instrument into a computer system with software in place. Using calipers, measure the distance between the outside of two parallel jaws. Type the distance in the stretch field in the instrument settings tab and click on calibrate stretch underneath the tab.Following this, laterally fit a polyurethane nanopore membrane of appropriate sizing for analysis onto the jaws with the nanopore ID number facing upward. Then stretch the jaws to the stretch required for analysis using the stretch adjustment handle on the side of the instrument. Place 80 microliters of PBST buffer in the lower fluid cell beneath the nanopore, ensuring there are no bubbles present that may affect the measurement.Now click the upper fluid cell into place and add 40 microliters of buffer, ensuring there are no bubbles present. Then place a faraday cage over the system and apply an external pressure as described in the text protocol. After placing 40 microliters of the calibration particles into the upper fluid cell, complete a TRPS measurement at three applied voltages.Alter the voltage by clicking on the plus and minus buttons on the voltage scale in the instrument settings tab in the software. Check that the three voltages return the appropriate background currents. And ensure that at the medium voltage, the calibration particles produce an average blockade magnitude of at least 0.3 nanoamperes.Once the conditions outlined in the text protocol have been achieved, start the run by clicking start in the software in the data acquisition tab. To complete the measurement, click stop in the data acquisition tab and save the data file. Wash the system by replacing the calibration particles with 40 microliters with PBST buffer into the upper fluid cells several times.And applying various pressures until no more blockade events are present, ensuring there are no residual particles and no cross contamination. After the appropriate baseline current is achieved, replace the electrolyte in the upper fluid cell with 40 microliters of sample. Start the sample run by clicking start in the data acquisition tab.Record a minimum of 500 particles and ensure the run time is a minimum of 30 seconds. To complete the measurement, click stop in the data acquisition tab and save the data file. An example of size and zeta potential analysis of streptavidin coated particles with no modifications and streptavidin coated particles saturated with single stranded DNA on the surface is shown here.Although both samples were of a similar size, the zeta potential was significantly different and much larger when DNA was functionalized onto the particle surface. The size and zeta potential data exhibited for samples with the lowest an highest concentrations of DNA hybridized to the streptavidin coated particles is displayed here. A larger zeta potential value is recorded for particles hybridized with a higher concentration of DNA.The change in zeta potential measured for capture probed DNA only, a fully complementary DNA target, a middle binding DNA target, an end binding DNA target, and an overhanging DNA target is shown here. Once mastered, this technique can be done in 20 minutes if it is performed properly. While attempting this procedure it's important to remember to thoroughly wash a nanopole between each calibration and sample to ensure there is no cross contamination between samples and prevent any nanopole blocking.After its development, this technique paved the way for researchers in the field of biosenses to explore protein-protein and protein-DNA interactions in multiplex assays. After watching this video you should have a good understanding of how to obtain zeta potential using TRPS and prepare DNA modified particles for bioassays.

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

الموجات فوق الصوتية على النقيض المستهدفة علاج الاورام الدبقية في الفئران عن طريق تسليم المخدرات جسيمات متناهية الصغر ، إذ تضع وتذرية الاوعية الدموية الدقيقة

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

A Microfluidic-based Hydrodynamic Trap for Single Particles

A فخ هيدرودينامي ميكروفلويديك المستندة للجسيمات واحدة

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

الكمي والحجم التنميط من خارج الخلية عن طريق الحويصلات الانضباطي مقاوم نبض الاستشعار

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

A منصة ميكروفلويديك لتجهيز الدقة الصغيرة الحجم عينة واستخدامها لحجم الجسيمات البيولوجية منفصلة مع Microdevice الصوتية

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

قابلية التصوير خلية على السقالات غير شفافة - استخدام مثال على رواية محبوك التيتانيوم زراعة الاسنان

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

الانضباطي الهلاميات المائية من الرئوي خارج الخلية مصفوفة للثقافة خلية 3D

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

منصة ميكروفلويديك مع تعدد كشف الالكترونية لتتبع المكانية من الجسيمات

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

انتقال إشارات متعددة من خلال الألياف البصرية عن طريق واجهة الموجة تشكيل

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...

An Integrated System to Remotely Trigger Intracellular Signal Transduction by Upconversion Nanoparticle-mediated Kinase Photoactivation

نظام متكامل لتشغيل عن بعد توصيل الإشارة داخل الخلايا بوساطة نانوحبيبات Upconversion كيناز فوتواكتيفيشن

Upconversion nanoparticle (UCNP)-mediated photoactivation is a new approach to remotely control bioeffectors with much less phototoxicity and with deeper ...