Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Les auteurs remercient Izon Science Ltd pour leur soutien. Le travail a été soutenu par la Commission européenne pour la recherche (PCIG11-GA-2012-321836 Nano4Bio).

1. Faire de la saline tamponnée au phosphate avec du Tween-20 (PBST) Buffer <ol><li> Dissoudre un comprimé de PBS (0,01 M tampon phosphate 0,0027 M de chlorure de potassium, 0,137 M de chlorure de sodium, pH 7,4) dans 200 ml d&#39;eau déminéralisée (18,2 MQ cm). </li><li> Ajouter 100 ul (0,05 (v / v)%) Tween-20 à la solution tampon de 200 ml en tant que tensio-actif. </li></ol> 2. Préparation des normes de particules Carboxyl Polystyrène <ol><li> Vortexer les particules d&#39;étalonn...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

<html> Le calcul du potentiel zêta utilisé une méthode basée sur l&#39; étalonnage lié au travail par Arjmandi et al. 21. La durée de la translocation des particules lorsqu&#39;elles traversent un nanopore est mesurée en fonction de la tension appliquée, en utilisant une vitesse moyenne de champ électrique et de particules sur la totalité d&#39;un pore conique régulière. La mobilité électrophorétique est la dérivée de 1 / T (où T est la durée du blocage) par rapport à la tension, ...

nanoparticules fonctionnalisés sont de plus en plus populaire en tant que biocapteurs dans les deux domaines de la médecine et de l&#39;environnement. La possibilité de modifier la chimie de surface d&#39;une nanoparticule, avec de l&#39; ADN, par exemple, se révèle utile pour les systèmes de délivrance de médicaments ciblés 1 et de suivi des interactions ADN-protéines 2-4. Une propriété de nanoparticules de plus en plus commun étant utilisé dans des essais biologiques et dans la prestation de produits thérapeutiques est superparamagnétisme 5. particules superparamagnétiques (SPPS) sont extrêmement utiles pour identifier et éliminer les analytes spécifiques à partir de mélanges complexes et peuvent le faire avec la simple utilisation d&#39;un seul aimant. Une fois enlevés, les particules d&#39;analyte lié peuvent être caractérisés et analysés adaptés à l&#39;usage. Les procédés antérieurs utilisés pour la détection et la caractérisation des nanoparticules comprennent des techniques optiques telles que la diffusion dynamique de lumière (DLS), autrement connu comme la spectroscopie de corrélation de photons. Bien qu&#39;un saluttechnique de débit gh, DLS est limitée à être une technique basée sur la moyenne et lors de l&#39; analyse des échantillons multimodaux sans ajout de logiciels spécialisés, les plus grosses particules produisent un signal beaucoup plus dominante, laissant certaines des plus petites particules complètement inaperçues 6,7. Particule par particule techniques de caractérisation sont donc beaucoup plus favorable pour analyser nanoparticule et les systèmes de nanoparticules fonctionnalisés. technologies basées RPS sont basés sur l&#39;application d&#39;un champ électrique à un échantillon et la surveillance du mécanisme de transport des particules à travers un nanopore synthétique ou biologique. Une technique relativement récente de détection de nanoparticules et la caractérisation basée sur RPS est résistive accordable impulsion de détection (TRPS) 8-16. TRPS est un système à deux électrodes séparées par une membrane poreuse en élastomère, accordable. Une méthode accordable de pores permet analytes d&#39;une gamme de forme 17 et la taille à mesurer via leur transdes mécanismes de port à travers les pores. Les pores accordables ont déjà été utilisés pour la détection de petites particules (diamètre 70-95 nm) produisant des résultats comparables à d&#39; autres techniques telles que la spectroscopie électronique à transmission (MET) 10. Lorsqu&#39;un champ électrique est appliqué, un courant ionique est observé et que des particules / molécules passent à travers les pores, ils bloquent temporairement les pores, ce qui provoque une réduction du courant qui peut être défini comme un «événement de blocage. Chaque événement de blocus est représentatif d&#39;une seule particule de sorte que chaque particule dans un échantillon peut être caractérisé individuellement en fonction de l&#39;ampleur du blocus, Δ <img alt="L&#39;équation 1" src="/files/ftp_upload/54577/54577eq1.jpg" /> Et toute la largeur à mi-hauteur, LMH, ainsi que d&#39; autres propriétés de blocus. L&#39;analyse des particules individuelles lors de leur passage à travers un nanopore est avantageux pour les échantillons multimodales comme TRPS peuvent réussir et efficacement distinguer une gamme de tailles de particules amongst un seul échantillon. Accordable détection d&#39;impulsion résistive complète taille 10, zeta potentiels 12,18 et la concentration de 15 mesures simultanément en une seule opération et peut donc différencier encore des échantillons de semblable, sinon la même taille par leur charge de surface 19; un avantage par rapport aux techniques de dimensionnement alternatives. Le potentiel zêta est défini comme étant le potentiel électrostatique au niveau du plan de cisaillement 20, et elle est calculée à partir des vitesses de particules comme ils traversent un pore 19. mesures de potentiel Zeta de particules individuelles donne ainsi un aperçu des mécanismes et le comportement des systèmes de nanoparticules en solution, de précieuses informations pour l&#39;avenir des modèles de test de nanoparticules pour une gamme d&#39;applications translocation. analyse de particules par particule de cette nature permet également la diffusion et la distribution des valeurs de potentiel zêta parmi un échantillon de population à explorer, permettant plus d&#39;informations ocinétique n de réaction (simple brin à l&#39;ADN double brin, par exemple) et des stabilités de particules en solution à atteindre. Ici, nous décrivons une technique qui détecte et caractérise les deux surfaces SPP non modifiées et modifiées par l&#39;ADN. Le protocole décrit ici est applicable à toute une gamme de nanoparticules inorganiques et biologiques, mais nous démontrons la procédure en utilisant des surfaces d&#39;ADN modifiées en raison de leur large éventail d&#39;applications. Cette technique permet à l&#39;utilisateur de distinguer entre les cibles d&#39;ADN simple brin et double brin sur une surface nanoparticulaire, sur la base des vitesses de translocation de particules à travers un système de pores et donc leurs potentiels zêta.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

technologies de Nanopore, connus collectivement comme capteurs de pulsations résistifs (RPS), sont utilisées pour détecter, quantifier et caractériser les protéines, les molécules et les nanoparticules. détection d&#39;impulsion résistive accordable (de TRPS) est une adaptation relativement récente au RPS qui incorpore un pore accordable peut être modifiée en temps réel. Ici, nous utilisons TRPS pour surveiller les temps de translocation des nanoparticules d&#39;ADN modifiées comme ils traversent la membrane poreuse réglable en fonction de la concentration d&#39;ADN et de la structure ( par exemple, simple brin en ADN double brin). TRPS repose sur deux électrodes Ag / AgCl, séparés par une membrane poreuse en élastomère qui établit un courant ionique stable lors d&#39;un champ électrique appliqué. Contrairement à diverses technologies de caractérisation des particules optiques à base, TRPS peuvent caractériser des particules individuelles dans une population de l&#39;échantillon, ce qui permet pour les échantillons multimodales à analyser avec facilité. Ici, nous démontrons mesures du potentiel zêtavia des vitesses de translocation de particules de normes connues et les appliquer à l&#39;échantillon des temps de translocation analyte, conduisant ainsi à la mesure du potentiel zeta de ces analytes. En plus d&#39;acquérir des valeurs de potentiel zêta moyennes, les échantillons sont tous mesurés en utilisant une perspective particule par particule présentant plus d&#39;informations sur un échantillon donné par l&#39;échantillon répartition de la population, par exemple. De ce fait, cette méthode démontre un potentiel dans les applications de détection pour les domaines médicaux et environnementaux.

<img alt="Figure 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> Figure 1. Représentation schématique des procédés de purification magnétique et une mesure de TRPS. A) Exemple de purification magnétique de l&#39; échantillon à partir d&#39;un échantillon contenant un excès, l&#39; ADN de sonde de capture non lié. B) TRPS exemple de mesure i) des particules passant par le nanopore et ii) événement Blockade produite à ...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Ici, nous utilisons un nanopore accordable en polyuréthane intégré dans une technique de détection d&#39;impulsions résistif pour caractériser les nanoparticules de la chimie de surface par la mesure des vitesses de translocation de particules, qui peut être utilisé pour déterminer le potentiel zéta des nanoparticules individuelles.

Détermination du potentiel Zeta via nanoparticulaires translocation Velocities à travers un accordable Nanopore: Utilisation de particules d&#39;ADN modifié comme un exemple

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

L&#39;échographie de contraste ciblées traitement des gliomes chez la souris via la livraison de drogue nanoparticules-Bearing et l&#39;ablation microvasculaire

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

Recherche

Bio-ingénierie

A Microfluidic-based Hydrodynamic Trap for Single Particles

Un piège hydrodynamique microfluidique à base de particules uniques

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Quantification et Taille-profilage des vésicules extracellulaires Utilisation accordable résistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Hydrogel Nanoparticle Harvesting of Plasma or Urine for Detecting Low Abundance Proteins

Hydrogel nanoparticules récolte de plasma ou l&#39;urine pour la détection des protéines de faible abondance

Novel biomarker discovery plays a crucial role in providing more sensitive and specific disease detection. Unfortunately many low-abundance biomarkers ...

Fabrication of Mechanically Tunable and Bioactive Metal Scaffolds for Biomedical Applications

Fabrication de mécanique accordable et bioactifs Métal échafaudages pour des applications biomédicales

Biometal systems have been widely used for biomedical applications, in particular, as load-bearing materials. However, major challenges are high stiffness ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Imaging Cell Viability on Non-transparent Scaffolds ÃƒÂ¢Ã¢â€šÂ¬Ã¢â‚¬Â Using the Example of a Novel Knitted Titanium Implant

Imagerie cellulaire Viabilité sur Echafaudages non transparents - Utilisation de l&#39;exemple d&#39;un roman en maille de titane Implant

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

Accordable hydrogels de matrice extracellulaire pulmonaire pour la 3D Culture Cellulaire

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Plate-forme microfluidique avec multiplexée Détection électronique pour le suivi spatial des particules

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

Transmission des signaux multiples à travers une fibre optique utilisant Wavefront Shaping

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...