Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Die Autoren danken Izon Science Ltd für ihre Unterstützung. Die Arbeit wurde von der Europäischen Kommission für Forschung (PCIG11-GA-2012-321836 Nano4Bio) unterstützt.

1. Herstellung der Phosphat-gepufferte Saline mit Tween-20 (PBST) Puffer <ol><li> Auflösen einer Tablette PBS (0,01 M Phosphatpuffer, 0,0027 M Kaliumchlorid, 0,137 M Natriumchlorid, pH 7,4) in 200 ml deionisiertem Wasser (18,2 M &amp; OHgr; cm). </li><li> Füge 100 &amp; mgr; l (0,05 (v / v)%) Tween-20 in die 200 ml Pufferlösung als Tensid. </li></ol> 2. Vorbereitung Carboxylende Polystyrolteilchengröße Standards <ol><li> Vortexen die Kalibrierungspartikeln für 30 sec vor der Beschallung...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

<html> Die Berechnung für das Zeta - Potential verwendet , um eine Kalibrierung basierte Methode verwandt von Arjmandi arbeiten et al. 21. Die Dauer der Translokation von Teilchen, wie sie eine Nanopore durchqueren, als eine Funktion der angelegten Spannung gemessen wird, eine mittlere elektrische Feld und Partikelgeschwindigkeiten über die Gesamtheit eines regelmäßigen konischen Pore verwenden. Die elektrophoretische Mobilität ist die Ableitung von 1 / T in Bezug auf die Spannung (wobei T die Da...

Funktionalisierte Nanopartikel werden immer beliebter als Biosensoren sowohl in medizinischen und ökologischen Bereich. Die Fähigkeit , eine Nanopartikel der Oberflächenchemie, die mit DNA, beispielsweise zu verändern, erweist sich nützlich für die gezielte Arzneimittelverabreichungssysteme 1 und Überwachung DNA-Protein - Wechselwirkungen 2-4. Eine zunehmend verbreitete Nanopartikel Eigenschaft wird in Biotests verwendet und bei der Bereitstellung von Therapeutika ist Superpara 5. Superparamagnetische Partikel (SPPS) sind äußerst nützlich bei der Identifizierung und spezifischen Analyten aus komplexen Mischungen zu entfernen und kann so mit der einfachen Verwendung eines einzigen Magneten tun. Einmal entfernt, kann der Analyt-gebundenen Teilchen charakterisiert und analysiert werden, für den Zweck geeignet. Frühere Verfahren verwendet zum Nachweis und zur Charakterisierung von Nanoteilchen umfassen optische Techniken, wie beispielsweise dynamische Lichtstreuung (DLS), die auch als Photonenkorrelationsspektroskopie bekannt. Obwohl ein hallogh Durchsatz Technik wird DLS beschränkt zu sein , eine Mittelungs basierte Technik und bei der Analyse von multimodalen Proben ohne die Zugabe von Spezialsoftware, die größeren Teilchen eine viel dominanter Signal, produzieren einige der kleineren Teilchen völlig unbemerkt 6,7 zu verlassen. Particle-by-Teilchen sind Charakterisierungstechniken daher wesentlich günstiger Nanopartikel und funktionalisierte Nanopartikel-Systeme zu analysieren. RPS basierten Technologien basieren auf ein elektrisches Feld an eine Probe Aufbringen und Überwachen des Transportmechanismus der Partikel durch einen synthetischen oder biologischen Nanopore. Eine relativ neue Nanopartikel - Detektion und Charakterisierung Technik basiert auf RPS ist abstimmbaren Widerstandspulserkennung (TRPS) 16.08. TRPS ist ein Zwei-Elektrodensystem durch ein elastomeres, abstimmbaren Porenmembran getrennt. Abstimmbarer Poren Verfahren ermöglicht Analyten aus einer Reihe von Form 17 und eine Größe über ihre trans zu messPort-Mechanismen durch die Pore. Abstimmbaren Poren wurden zuvor für die Detektion von kleinen Partikeln (70-95 nm Durchmesser) Herstellung vergleichbare Ergebnisse zu anderen Techniken , wie beispielsweise Transmissionselektronenspektroskopie (TEM) 10 verwendet. Wenn ein elektrisches Feld angelegt wird, wird ein Ionenstrom beobachtet und als Partikel / Moleküle durch die Poren passieren, sie vorübergehend die Poren blockieren, eine Verringerung der Strom zu verursachen, die als &quot;Blockade Ereignis&quot; definiert werden kann. Jede Blockade Ereignis ist repräsentativ für ein einzelnes Teilchen , so dass jedes Teilchen in einer Probe einzeln auf der Blockade Größe basierend charakterisiert werden kann, Δ <img alt="Gleichung 1" src="/files/ftp_upload/54577/54577eq1.jpg" /> Halb Maximum und voller Breite, FWHM, sowie andere Blockade Eigenschaften. Analysieren von einzelnen Teilchen, wie sie durch eine Nanopore passieren ist vorteilhaft für die multimodale Proben als TRPS erfolgreich und effektiv eine Reihe unterscheiden von Partikelgrößen amongst eine einzelne Probe. Tunable resistive Pulserfassungs vervollständigt Größe 10, Zetapotential 12,18 und Konzentration 15 Messungen gleichzeitig in einem einzigen Durchlauf und kann daher noch unterscheiden Proben ähnlich, wenn nicht die gleiche Größe durch ihre Oberflächenladung 19; ein Vorteil gegenüber alternativen Sizing-Techniken. Zeta - Potential ist als das elektrostatische Potential an der Scherebene 20 definiert ist , und wird aus Partikelgeschwindigkeiten berechnet , da sie eine Pore 19 durchqueren. Zeta-Potential-Messungen einzelner Partikel gibt damit einen Einblick in die Translokation Mechanismen und das Verhalten der Nanopartikel-Systemen in Lösung, wertvolle Informationen für die Zukunft von Nanopartikel-Assay-Designs für eine Vielzahl von Anwendungen. Particle-by-Partikelanalyse solcher Art, ermöglicht auch die Verbreitung und Verteilung von Zetapotentialwerte unter einer Stichprobe untersucht werden, um weitere Informationen erlauben on Reaktionskinetik (einzelsträngig zu doppelsträngiger DNA, zum Beispiel) und Partikelstabilitäten in Lösung erreicht werden. Hier beschreiben wir eine Technik, und charakterisiert Oberflächen sowohl unmodifizierte und DNA-modifizierten SPP erkennt. Das beschriebene Protokoll ist hier anwendbar auf eine Reihe von anorganischen und biologischen Nanopartikel, aber wir demonstrieren das Verfahren DNA-modifizierten Oberflächen aufgrund ihrer breiten Palette von Anwendungen. Die Technik ermöglicht es dem Benutzer, zwischen einzelsträngigen und doppelsträngigen DNA-Ziele auf einer Nanopartikeloberfläche zu unterscheiden, basierend auf Partikel Translokation Geschwindigkeiten durch ein Porensystem und somit deren Zeta-Potentiale.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

Nanopore Technologien, die zusammen als Resistive Pulssensoren (RPS) bekannt ist, werden verwendet, um Proteine, Moleküle und Nanopartikel zu erkennen, zu quantifizieren und zu charakterisieren. Tunable resistive Pulserkennung (TRPS) ist eine relativ neue Anpassung an RPS, die einen abstimmbaren Poren enthält, die in Echtzeit verändert werden kann. Hier wir TRPS verwenden , um die Translokation Zeiten von DNA-modifizierten Nanopartikel zu überwachen , da sie die abstimmbaren Porenmembran als Funktion der DNA - Konzentration und Struktur (dh einzelsträngig zu doppelsträngiger DNA) durchqueren. TRPS basiert auf zwei Ag / AgCl Elektroden durch eine elastomere Porenmembran getrennt, die eine stabile Ionenstrom auf ein angelegtes elektrisches Feld aufbaut. Im Gegensatz zu verschiedenen optisch-basierten Partikelcharakterisierung Technologien können TRPS charakterisieren einzelnen Partikel unter einer Probenpopulation, so dass für multimodale Proben mit Leichtigkeit analysiert werden. Hier zeigen wir, Zetapotentialmessungenüber Partikel Translokation Geschwindigkeiten von bekannten Standards und wenden diese Analyten Translokation mal abzutasten, wodurch sich das Zetapotential dieser Analyten zu messen. Sowie Mittel zeta Potentialwerte Erfassen werden die Proben alle unter Verwendung eines Partikel-by-Teilchen Perspektive zeigen weitere Informationen auf einer gegebenen Probe durch die Probenpopulation Verteilungen, zum Beispiel. Von solchen, zeigt dieses Verfahren Potential in Sensoranwendungen für beide medizinischen und ökologischen Bereich.

<img alt="Abbildung 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> Abbildung 1 : Schematische Darstellung der Prozesse der magnetischen Reinigung und einer TRPS Messung. A) Beispiel für magnetische Reinigung von Probe mit einer Probe ausgehend enthält überschüssige, nicht gebundene Einfang - Sonde DNA. B) trpS Meßbeispiel i) Partikel durch die Nanopore vorbei und ii) Blockade Ereignis von Teilchen vorübergehend verschließe...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Hier verwenden wir ein Polyurethan abstimmbaren Nanopore in eine resistive Pulserfassungstechnik integriert Nanoteilchen Oberflächenchemie über die Messung der Partikelgeschwindigkeiten Translokation zu charakterisieren, die verwendet werden können, das Zeta-Potential der einzelnen Nanopartikel zu bestimmen.

Bestimmung des Zetapotentials über Nanoparticle Translokation Geschwindigkeiten durch eine Tunable Nanopore: Die Verwendung von DNA-modifizierten Partikel als Beispiel

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

The overall goal of this procedure is to characterize the surface chemistry of nano particles using tunable resistant post sensing, or TRPS, and determine the zeta potential of the material. This is demonstrating by characterizing DNA modified nano particles. This method can help answer key questions in the characterization of nanomaterials and the development of bioassay.The main advantage of this technique is that you can complete particle by particle analysis. Each DNA particle signal is translated into a zeta potential measurement, providing a complete picture of the sample being analyzed. The oldest method could provide insight into the characterization of materials.It can also be applied to other applications, such as the development of bioassay for the detection of cells, viruses, DNA, and proteins. Generally, individual new to this method will struggle because it's not a simple inject the samp and then wait for the answer. There is some input from the scientist needed.To begin this procedure, vortex streptavidin coated particles for 30 seconds before sonication for two minutes at 80 watts to assure mono dispersity. Dilute the streptavidin coated particles one in one hundred in PBST buffer to achieve a resulting concentration of one times ten to the nine particles per milliliter. Then vortex the particles for 30 seconds.Based on a binding capacity of 4, 352 picomols per milligram at the appropriate concentration of DNA to the particles for resulting concentrations of 10, 20, 30, 40, 47, 95, 140, and 210 nanomolar. After vortexing the samples for 10 seconds, place them on a rotary wheel at room temperature for 30 minutes to allow the DNA to bind to the particle surfaces via a streptavidin biotin interaction. Once the captured DNA has been added and incubated with the particles, remove the excess DNA and solution via magnetic separation by placing the samples onto a magnetic rack for 30 minutes.Following this, remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. Now add the required amount of target DNA to each sample to ensure the maximum possible target binding was reached.Vortex the samples for 10 seconds. And place them on the rotary wheel at room temperature for 30 minutes. Once the hybridization is complete, remove the excess target DNA via magnetic separation by placing the samples onto the magnetic rack for 30 minutes.Next remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. After repeating the previous steps for duplicate samples, place the samples on the rotary wheel at room temperature for 16 hours to investigate DNA hybridization times.At this point, plug in a TRPS instrument into a computer system with software in place. Using calipers, measure the distance between the outside of two parallel jaws. Type the distance in the stretch field in the instrument settings tab and click on calibrate stretch underneath the tab.Following this, laterally fit a polyurethane nanopore membrane of appropriate sizing for analysis onto the jaws with the nanopore ID number facing upward. Then stretch the jaws to the stretch required for analysis using the stretch adjustment handle on the side of the instrument. Place 80 microliters of PBST buffer in the lower fluid cell beneath the nanopore, ensuring there are no bubbles present that may affect the measurement.Now click the upper fluid cell into place and add 40 microliters of buffer, ensuring there are no bubbles present. Then place a faraday cage over the system and apply an external pressure as described in the text protocol. After placing 40 microliters of the calibration particles into the upper fluid cell, complete a TRPS measurement at three applied voltages.Alter the voltage by clicking on the plus and minus buttons on the voltage scale in the instrument settings tab in the software. Check that the three voltages return the appropriate background currents. And ensure that at the medium voltage, the calibration particles produce an average blockade magnitude of at least 0.3 nanoamperes.Once the conditions outlined in the text protocol have been achieved, start the run by clicking start in the software in the data acquisition tab. To complete the measurement, click stop in the data acquisition tab and save the data file. Wash the system by replacing the calibration particles with 40 microliters with PBST buffer into the upper fluid cells several times.And applying various pressures until no more blockade events are present, ensuring there are no residual particles and no cross contamination. After the appropriate baseline current is achieved, replace the electrolyte in the upper fluid cell with 40 microliters of sample. Start the sample run by clicking start in the data acquisition tab.Record a minimum of 500 particles and ensure the run time is a minimum of 30 seconds. To complete the measurement, click stop in the data acquisition tab and save the data file. An example of size and zeta potential analysis of streptavidin coated particles with no modifications and streptavidin coated particles saturated with single stranded DNA on the surface is shown here.Although both samples were of a similar size, the zeta potential was significantly different and much larger when DNA was functionalized onto the particle surface. The size and zeta potential data exhibited for samples with the lowest an highest concentrations of DNA hybridized to the streptavidin coated particles is displayed here. A larger zeta potential value is recorded for particles hybridized with a higher concentration of DNA.The change in zeta potential measured for capture probed DNA only, a fully complementary DNA target, a middle binding DNA target, an end binding DNA target, and an overhanging DNA target is shown here. Once mastered, this technique can be done in 20 minutes if it is performed properly. While attempting this procedure it's important to remember to thoroughly wash a nanopole between each calibration and sample to ensure there is no cross contamination between samples and prevent any nanopole blocking.After its development, this technique paved the way for researchers in the field of biosenses to explore protein-protein and protein-DNA interactions in multiplex assays. After watching this video you should have a good understanding of how to obtain zeta potential using TRPS and prepare DNA modified particles for bioassays.

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

Contrast Ultrasound gezielte Behandlung von Gliomen in Mäusen über Drug-Bearing Nanopartikel Liefer-und mikrovaskuläre Ablation

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

Forschung

Biotechnik

A Microfluidic-based Hydrodynamic Trap for Single Particles

Einem mikrofluidischen-basierte Hydrodynamische Trap für einzelne Teilchen

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Quantifizierung und Größe-Profilierung der extrazellulären Vesikeln Mit Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

Einem mikrofluidischen Plattform für Präzisions-Kleinvolumen Probenbearbeitung und seine Verwendung zur Größe Separate biologische Partikel mit einem Acoustic Microdevice

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Imaging Zelllebensfähigkeit auf Undurchsichtige Scaffolds - am Beispiel eines neuartigen Strick-Titan-Implantat

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

Tunable Hydrogele aus Pulmonary Extrazellulärmatrix für 3D-Zellkultur

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Mikrofluidik-Plattform mit Multiplexed elektronische Sensoren für Raumverfolgung von Partikeln

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

Die Übertragung von mehreren Signalen über eine optische Faser Mit Wavefront-Shaping

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...

An Integrated System to Remotely Trigger Intracellular Signal Transduction by Upconversion Nanoparticle-mediated Kinase Photoactivation

Ein integriertes System aus der Ferne intrazelluläre Signaltransduktion von Großbildschirmen Nanoparticle vermittelte Kinase Photoaktivierungen auslösen

Upconversion nanoparticle (UCNP)-mediated photoactivation is a new approach to remotely control bioeffectors with much less phototoxicity and with deeper ...