Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

המחברים מודים Izon מדע בע&quot;מ על תמיכתם. העבודה נתמכה על ידי הנציבות האירופית למחקר (PCIG11-GA-2,012-321,836 Nano4Bio).

1. ביצוע בופר פוספט עם Tween-20 (PBST) חוצץ <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ממיסים טבליה אחת PBS (0.01 M פוספט חיץ, 0.0027 M אשלגן כלוריד, 0.137 M נתרן כלוריד, pH 7.4) ב 200 מ&quot;ל מים deionized (18.2 MΩ ס&quot;מ). </li><li style=";text-align:right;direction:rtl"> הוספת 100 μl (0.05 (v / v)%) Tween-20 הפתרון 200 מ&quot;ל חיץ בתור...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

<html> החישוב עבור פוטנציאל זטה השתמש בשיטה המבוססת כיול הקשורים לעבודת Arjmandi et al. 21. משך טרנסלוקציה של חלקיקים כאשר הם חוצים nanopore נמדדת כפונקציה של מתח מיושם, באמצעות מהירויות שדה חלקיק חשמליות ממוצע על המכלול של נקבובי חרוטים קבועים. ניידות electrophoretic היא נגזרת...

חלקיקים פונקציונליים הופכים פופולריים יותר ויותר כמו biosensors בשני תחומי בריאות והסביבה. היכולת לשנות כימיה השטח של ננו-חלקיקים, עם DNA, למשל, היא להוכיח שימושי עבור מערכות שיגור תרופות 1 ואינטראקציות חלבון דנ&quot;א ניטור 2-4. מאפיין nanoparticle נפוץ יותר ויותר מנוצל bioassays ו באספקה הרפויה הוא פאראמגנטיות על 5. חלקיקים פאראמגנטי (SPPs) הם מאוד שימושיים בזיהוי וסרת analytes הספציפי מתערובות מורכבות ויכולים לעשות זאת עם השימוש פשוט של מגנט יחיד. הוסר לאחר, החלקיקים הנכנס אנליטי ניתן לאפיין ולנתח מתאימים למטרה. שיטות שהופעלו לצורך זיהוי והאפיון של חלקיקים כוללות שיטות אופטיות כגון פיזור אור דינאמי (DLS), הידוע גם בשם ספקטרוסקופיה קורלציה הפוטון. למרות הייטכניקת תפוקת GH, DLS מוגבל להיות טכניקת מיצוע מבוססת בעת ניתוח דגימות multimodal ללא תוספת של תוכנה מומחית, החלקיקים הגדולים יותר יפיקו אות דומיננטית הרבה יותר, ומשאיר חלק החלקיקים הקטנים לחלוטין 6,7 מעיניהם. חלקיקים-ידי חלקיק טכניקות אפיון ולכן הם הרבה יותר נוחים לנתח ננו-חלקיקים ומערכות ננו-חלקיקים פונקציונליים. טכנולוגיות מבוססות RPS מבוססות סביב החלת שדה חשמלי מדגם וניטור מנגנון התחבורה של החלקיקים באמצעות nanopore סינטטי או ביולוגי. ננו-חלקיק חדש יחסית טכניקת זיהוי ואפיון מבוססת על RPS היא החישה הדופקת resistive מתכונן (TRPS) 8-16. TRPS היא מערכת דו-אלקטרודה המופרדת על ידי קרום נקבובי אלסטומרי, מתכונן. שיטה נקבובית מתכונן מאפשרת analytes של מגוון של צורה 17 וגודל להימדד באמצעות שלהם טרנסמנגנוני יציאה דרך הנקבוביות. הנקבוביות מתכוננות בעבר שמשו לצורך זיהוי של חלקיקים קטנים (בקוטר ננומטר 70-95) בהפקת תוצאות דומות טכניקות אחרות כגון ספקטרוסקופיה אלקטרוני הילוכים (TEM) 10. כאשר שדה חשמלי מוחל, זרם יוני הוא ציין כחלקיקים / מולקולות לעבור דרך הנקבובית, הם חוסמים זמנית את הנקבוביות, מה שגרם לירידה הנוכחית יכול להיות מוגדרת כ &quot;אירוע מצור&quot;. אירוע מצור כל הוא נציג של חלקיק בודד, כך שכל חלקיקים בתוך מדגם ניתן לאפיין באופן אישי המבוסס על גודל המצור, Δ <img alt="משוואה 1" src="/files/ftp_upload/54577/54577eq1.jpg" /> , ורוחב מלא ערך חצי, FWHM, וכן נכסי מצור אחרים. ניתוח חלקיקים בודדים כשהם עוברים דרך nanopore הוא יתרון עבור דגימות multimodal כמו TRPS יכול בהצלחה וביעילות להבחין במגוון של החלקיקים גדלים עמוןGST מדגם יחיד. חישת דופק התנגדות מתכוונן משלימה גודל 10, 12,18 ו -15 מדידות ריכוז פוטנציאל זטה זמנית בטווח אחת ולכן יכולה עדיין להבדיל דגימות של דומה, אם לא באותו הגודל על ידי תשלום השטח שלהם 19; יתרון על פני טכניקות אומדות חלופיות. פוטנציאל זטה מוגדר הפוטנציאל אלקטרוסטטי על המטוס של 20 גזירה, והוא מחושב מן מירויות חלקיקים כפי שהם חוצים נקבוביים 19. מדידות פוטנציאל זטה של ​​חלקיקים בודדים ובכך נותנות תובנה מנגנוני טרנסלוקציה וההתנהגות של מערכות ננו-חלקיקים בתמיסה, מידע רב ערך עבור העתיד של עיצובי assay nanoparticle עבור מגוון רחב של יישומים. החלקיקים-ידי חלקיק ניתוח של אופי כזה גם מאפשר פריסה והפצה של ערכי פוטנציאל זטה בקרב אוכלוסייה מדגם כדי להיחקר, המאפשר למידע נוסף oקינטיקה תגובת n (חד גדילי הדנ&quot;א הדו-גדילית, למשל) ואת יציבות חלקיקים בתמיסה כדי להיות מושגת. כאן אנו מתארים טכניקת מאתר המאפיינת הן ללא שינוי ו-שונה DNA משטחי SPP. הפרוטוקול המתואר במסמך זה חל על מגוון של חלקיקים אורגניים וביולוגיים, אבל אנחנו מדגימים את ההליך באמצעות משטחים-modified DNA בשל המגוון הרחב של יישומים שלהם. הטכניקה מאפשרת למשתמש להבחין בין מטרות דנ&quot;א חד-גדילי ו פעמיים תקועים על משטח ננו-חלקיקים, מבוסס על מהירויות טרנסלוקציה החלקיקים באמצעות מערכת הנקבוביות ובכך פוטנציאל זטה שלהם.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

טכנולוגיות nanopore, הידוע קולקטיבי חיישנים דופק התנגדותי (RPS), נמצאים בשימוש כדי לזהות, לכמת ולאפיין חלבונים, מולקולות חלקיקים. חישת דופק התנגדות מתכוונן (TRPS) היא עיבוד אחרון יחסית RPS שמשלב נקבובי מתכונן כי ניתן לשנות בזמן אמת. כאן, אנו משתמשים TRPS לפקח על הפעמים טרנסלוקציה של חלקיקים שונים DNA כפי שהם חוצים את הממברנה הנקבובית מתכוננת כפונקציה של ריכוז ה- DNA מבני (כלומר, חד גדילי הדנ&quot;א פעמים תקועות). TRPS מבוסס על שתי אלקטרודות Ag / AgCl, מופרדות על ידי קרום נקבובי אלסטומרי מקים זרם יוני יציב על שדה חשמלי מיושם. בניגוד לטכנולוגיות אפיון חלקיקים אופטיים מבוסס שונות, TRPS יכול לאפיין חלקיקים בודדים בקרב אוכלוסייה מדגמת, המאפשר דגימות multimodal להיות מנותחות בקלות. הנה, אנחנו מדגימים מדידות פוטנציאל זטהבאמצעות מהירויות טרנסלוקציה חלקיקים של סטנדרטים ידועים ולהחיל אלה לדגום פעמי טרנסלוקציה אנליטי, ולכן תוצאת מדידת פוטנציאל זטה של ​​analytes אלה. כמו גם רכישת ערכי פוטנציאל זטה ממוצעים, הדגימות נמדדות כל משתמש פרספקטיבת חלקיק אחר חלקיק מציגה מידע נוסף על מדגם נתון בדרך של חלוקות אוכלוסיית מדגם, למשל. על כך, שיטה זו ממחישה את פוטנציאל בתוך יישומי חישה לשני תחומי הבריאות והסביבה.

<img alt="איור 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> באיור 1. ייצוג סכמטי של תהליכי טיהור מגנטי מדידה TRPS. א) דוגמא של טיהור המגנטית של מדגם החל מדגם המכיל עודף, DNA בדיקה ללכוד מאוגד. B) TRPS למשל מדידת i) חלקיקים העוברים דרך nanopore ו ii) אירוע מצ...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

כאן אנו משתמשים nanopore מתכונן פוליאוריטן משולבים טכניקה חישה הדופק resistive לאפיין כימיה של פני השטח חלקיקים באמצעות מדידת מהירויות טרנסלוקציה החלקיקים, אשר ניתן להשתמש בהם כדי לקבוע את הפוטנציאל זטא של חלקיקים בודדים.

קביעת פוטנציאל זטה באמצעות Nanoparticle טרנסלוקציה מהירויות באמצעות nanopore מתכוונן: באמצעות חלקיקים שונה-DNA כמשל

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

אולטראסאונד ניגודיות ממוקד טיפול gliomas של עכברים באמצעות אספקת סמים נושאות Nanoparticle ו אבלציה כלי הדם

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

A Microfluidic-based Hydrodynamic Trap for Single Particles

Microfluidic מבוססי הידרודינמית מלכודת חלקיקים יחיד

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

כימות וגודל-פרופיל של תאית שלפוחית ​​באמצעות Pulse חישה מתכוונן התנגדותי

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Hydrogel Nanoparticle Harvesting of Plasma or Urine for Detecting Low Abundance Proteins

הידרוג&#39;ל Nanoparticle קציר של פלזמה או שתן לגילוי חלבונים שפע נמוך

Novel biomarker discovery plays a crucial role in providing more sensitive and specific disease detection. Unfortunately many low-abundance biomarkers ...

Fabrication of Mechanically Tunable and Bioactive Metal Scaffolds for Biomedical Applications

המצאה של מכאני מתכוונן ויו מתכת פיגומים עבור יישומים ביו

Biometal systems have been widely used for biomedical applications, in particular, as load-bearing materials. However, major challenges are high stiffness ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Imaging Cell Viability on Non-transparent Scaffolds ÃƒÂ¢Ã¢â€šÂ¬Ã¢â‚¬Â Using the Example of a Novel Knitted Titanium Implant

כדאיות התא הדמיה על פיגומים ללא שקוף - לפי הדוגמה של שתל טיטניום סרוגה Novel

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

הידרוג מתכוונן מ מטריקס ריאתי עבור תרבית תאים 3D

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

פלטפורמת microfluidic עם איתור Multiplexed אלקטרוני למערכות מעקב מרחבית של חלקיקים

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

העברת אותות מרובים דרך סיב אופטי באמצעות Wavefront לעיצוב

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...