Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Yazarlar, desteklerinden dolayı Izon Bilim Ltd teşekkür ederim. iş Research (PCIG11-GA-2012-321836 Nano4Bio) için Avrupa Komisyonu tarafından desteklenmiştir.

1. Tween-20 (PBST) Tamponu ile fosfat tamponlu tuzlu su yapma <ol><li> 200 ml deiyonize su (18.2 cm) bir PBS tablet (0.01 M fosfat tamponu, 0.0027 M potasyum klorür, 0.137 M sodyum klorür, pH 7.4) içinde çözülür. </li><li> bir yüzey aktif madde olarak 200 ml tampon çözeltiye 100 ul (0.05 (hac / hac)%) Tween-20 ekleyin. </li></ol> 2. Karboksil Polistiren Parçacık Standartları Hazırlama <ol><li> parçacıkların bir tekli dağılırlık oluşturmak için 80 watt olarak 2 dakika bo...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

<html> Zeta potansiyeli için hesaplama Arjmandi ve ark., 21 işe ilişkin bir kalibrasyon tabanlı yöntem kullanılır. parçacıkların translokasyonu süresi bir nanopore düzenli konik gözenek tümü boyunca bir ortalama elektrik alanı ve parçacık hızları kullanılarak, uygulanan voltajın bir fonksiyonu olarak ölçülür çapraz olarak. Elektroforetik mobilite algılama bölgesi uzunluğunun karesine, l ile çarpılan gerilime göre (T blokajı süresi) 1 / T türevidir. algılam...

Fonksiyonlu nanopartiküller, tıbbi ve çevresel alanlarda hem biyosensörler olarak giderek daha popüler hale gelmektedir. Kabiliyeti, örneğin, hedeflenen ilaç verme sistemleri 1 ve izleme, DNA-protein etkileşimleri 2-4 için yararlı olduğunu kanıtlamaktadır, DNA ile, bir nanopartikül yüzey kimyasını değiştirmek için. Giderek yaygınlaşan bir nanoparçacık mülkiyet biyo-deneylerde kullanılan ve terapötik teslim süperparamanyetizma 5&#39;tir ediliyor. Süpermanyetik parçacıklar (SPSS) belirlenmesi ve karmaşık karışımlarından özel analitleri çıkarılmasında son derece yararlıdır ve tek bir mıknatıs basit kullanımı ile bunu yapabilirsiniz. Bir kez çıkarıldı analit-bağlanmış parçacıklar, özelliği ve amaca uygun olarak analiz edilebilir. Nanopartiküllerin saptanması ve tanımlanması için kullanılan önceki metotlarda, aksi foton korelasyon spektroskopisi olarak bilinen bu dinamik ışık saçılımı (DLS) gibi optik teknikler bulunmaktadır. Bir hi rağmengh throughput tekniği, DLS bir ortalama bazlı teknik olmak ve uzman bir yazılım ilavesi olmadan multimodal numunelerin analiz ederken sınırlıdır, büyük partiküller 6,7 tamamen fark edilmeden küçük parçacıkların bazı bırakarak, çok daha baskın bir sinyal üretecek. Parçacık-by-parçacık karakterizasyon teknikleri bu nedenle çok daha olumlu nanoparçacık ve fonksiyonlaşmış nanoparçacık sistemlerini analiz etmek vardır. RPS tabanlı teknolojiler bir numuneye bir elektrik alanı uygulanması ve bir sentetik veya biyolojik nano-gözeneklere içinde parçacık taşıma mekanizması takip etrafında dayanmaktadır. RPS dayalı nispeten yeni nanoparçacık algılama ve karakterizasyonu tekniği ayarlanabilir direnç darbe algılama (TRPS) 8-16 olduğunu. TRPS bir elastomerik, ayarlanabilir bir gözenek membran ile ayrılmış, iki elektrod sistemidir. Ayarlanabilir bir gözenek yöntem, trans-ölçülebilir şekil 17 ve boyutu, bir dizi analitlerin sağlargözenek yoluyla liman mekanizmaları. Ayarlanabilir gözenekler, daha önce bu transmisyon elektron spektroskopisi (TEM), 10 gibi başka teknikler ile karşılaştırılabilir sonuçlar elde küçük parçacıkların saptanması (70-95 nm çapında) kullanılmıştır. bir elektrik alanı uygulandığında, iyonik akımı görülmektedir ve parçacıklar / molekülü gözenek geçerken, geçici olarak bir &quot;blokaj etkinliği&quot; olarak tanımlanabilir mevcut bir azalmaya neden gözenek bloke eder. Bir örnek içindeki her parçacık, özelliği tek tek blok büyüklüğü, ö göre böylece, her blokaj etkinliği tek bir parçacık temsili <img alt="denklem 1" src="/files/ftp_upload/54577/54577eq1.jpg" /> Ve tam genişliği yarım maksimum FWHM, hem de diğer blokaj özellikleri. bir nanopore geçerken tek tek parçacıkların analiz parçacık amon boyutları ve TRPS başarılı ve etkili bir dizi ayırt gibi multimodal numuneler için avantajlıdırTek bir örnek GST. Ayarlanabilir direnç darbe algılama boyutu 10, tek bir vadede aynı anda zeta potansiyeli 12,18 ve konsantrasyon 15 ölçümleri tamamlar ve hala benzer örnekleri ayırt nedenle eğer kendi yüzey yükü 19 tarafından değil aynı boyutta; Alternatif boyutlandırma teknikleri üzerinde bir avantaj. Zeta potansiyeli kesme 20 düzleminde elektrostatik potansiyel olarak tanımlanır ve bir gözenek 19 çapraz olarak parçacık hızları hesaplanır. Bireysel partiküllerin zeta potansiyel ölçümleri böylece translokasyon mekanizmaları ve çözelti içinde nanoparçacık sistemleri, uygulamaları bir dizi için nanoparçacık tahlil tasarımları geleceği için değerli bilgilerin davranış içine bir fikir verir. Bu tür doğa parçacık-by-parçacık analizi de o daha fazla bilgi için izin veren bir örnek halk arasında yayıldı ve zeta potansiyeli değerlerinin dağılımı keşfedilmeyi sağlarçözelti içinde n tepkime kinetik (örneğin, iki-şeritli DNA, tek bükümlü) ve partikül stabiliteleri elde edilmesi. Burada, algılar ve değiştirilmemiş ve DNA modifiye SPP yüzeyleri hem karakterize bir tekniği açıklar. Burada tarif edilen protokol, inorganik ve biyolojik nanopartiküllerin bir dizi için geçerli olmakla birlikte, bağlı uygulama bunların geniş bir DNA modifiye edilmiş yüzeyler kullanılarak prosedürü göstermektedir. tekniği Kullanıcı böylece partikül translokasyon bir gözenek sistemi ile hızları ve zeta potansiyeli göre bir nanopartikül yüzey üzerinde tek sarmallı ve çift sarmallı DNA hedefleri ayırt sağlar.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

Dirençli Darbe Sensörleri (RPS) olarak topluca bilinen nanopore teknolojileri, tespit ölçmek ve proteinler, moleküller ve nanopartiküller karakterize etmek için kullanılmaktadır. Ayarlanabilir direnç darbe algılama (TRPS) gerçek zamanlı olarak değişmiş olabilir ayarlanabilir bir gözenek içeren RPS için nispeten yeni bir uyarlamasıdır. Bunlar DNA konsantrasyonu ve yapısının bir fonksiyonu olarak ayarlanabilir bir gözenek membran çapraz olarak burada, DNA-modifiye edilmiş nanopartiküller translokasyon kez izlemek için TRPS kullanımı (örneğin, tek sarmallı iki-şeritli DNA&#39;ya). TRPS uygulanan bir elektrik alanı üzerine bir sabit iyon akımı oluşturan elastomerik bir gözenekli membran ile ayrılmış, iki Ag / AgCI elektrot dayanır. Çeşitli optik tabanlı parçacık karakterizasyonu teknolojilerinin aksine, TRPS modelli örnekleri kolaylıkla analiz edilmesi için izin, bir örnek nüfusu arasında bireysel parçacıklar karakterize edilebilir. Burada, zeta potansiyel ölçümleri göstermektedirBilinen standartların parçacık translokasyon hızlar aracılığı ile ve böylece bu analitlerin zeta potansiyelini ölçmek sonuçlanan analit translokasyon kez örneklemek için bu geçerlidir. Yanı sıra ortalama zeta potansiyeli değerleri elde olarak, numune, tüm Örneğin, örnek nüfustan vasıtası ile verilen bir örnek üzerinde daha ayrıntılı bilgi gösteren bir parçacık tarafından tanecikli perspektif kullanılarak ölçülür. Böyle ki, bu yöntem hem tıbbi ve çevresel alanlar için algılama uygulamaları içinde potansiyelini göstermektedir.

<img alt="Şekil 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> Manyetik saflaştırma ve TRPS ölçüm süreçlerinin 1. şematik gösterimi Şekil. Bir numune içeren fazlalığı, ilişkisiz yakalama prob DNA. B) ile başlayan numunenin manyetik arınma A) Örnek ölçüm örnek TRPS i) Parçacık geçici bir azalmaya neden nanopore geçerek ve ii) Blokaj olay gözenek parçac...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Burada tek tek nanopartiküllerin zeta potansiyelini belirlemek için kullanılabilir partikül translokasyon hızlarının ölçümü ile nanopartiküller yüzey kimyası karakterize etmek için bir dirençli darbe algılama tekniği entegre bir poliüretan ayarlanabilir Nanopore kullanımı.

Bir Ayarlanabilir Nanopore aracılığıyla Nanopartikül Translokasyon Hızları aracılığıyla Zeta Potansiyeli Belirlenmesi: Bir Örnek olarak DNA modifiye Parçacıklar kullanma

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

The overall goal of this procedure is to characterize the surface chemistry of nano particles using tunable resistant post sensing, or TRPS, and determine the zeta potential of the material. This is demonstrating by characterizing DNA modified nano particles. This method can help answer key questions in the characterization of nanomaterials and the development of bioassay.The main advantage of this technique is that you can complete particle by particle analysis. Each DNA particle signal is translated into a zeta potential measurement, providing a complete picture of the sample being analyzed. The oldest method could provide insight into the characterization of materials.It can also be applied to other applications, such as the development of bioassay for the detection of cells, viruses, DNA, and proteins. Generally, individual new to this method will struggle because it's not a simple inject the samp and then wait for the answer. There is some input from the scientist needed.To begin this procedure, vortex streptavidin coated particles for 30 seconds before sonication for two minutes at 80 watts to assure mono dispersity. Dilute the streptavidin coated particles one in one hundred in PBST buffer to achieve a resulting concentration of one times ten to the nine particles per milliliter. Then vortex the particles for 30 seconds.Based on a binding capacity of 4, 352 picomols per milligram at the appropriate concentration of DNA to the particles for resulting concentrations of 10, 20, 30, 40, 47, 95, 140, and 210 nanomolar. After vortexing the samples for 10 seconds, place them on a rotary wheel at room temperature for 30 minutes to allow the DNA to bind to the particle surfaces via a streptavidin biotin interaction. Once the captured DNA has been added and incubated with the particles, remove the excess DNA and solution via magnetic separation by placing the samples onto a magnetic rack for 30 minutes.Following this, remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. Now add the required amount of target DNA to each sample to ensure the maximum possible target binding was reached.Vortex the samples for 10 seconds. And place them on the rotary wheel at room temperature for 30 minutes. Once the hybridization is complete, remove the excess target DNA via magnetic separation by placing the samples onto the magnetic rack for 30 minutes.Next remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. After repeating the previous steps for duplicate samples, place the samples on the rotary wheel at room temperature for 16 hours to investigate DNA hybridization times.At this point, plug in a TRPS instrument into a computer system with software in place. Using calipers, measure the distance between the outside of two parallel jaws. Type the distance in the stretch field in the instrument settings tab and click on calibrate stretch underneath the tab.Following this, laterally fit a polyurethane nanopore membrane of appropriate sizing for analysis onto the jaws with the nanopore ID number facing upward. Then stretch the jaws to the stretch required for analysis using the stretch adjustment handle on the side of the instrument. Place 80 microliters of PBST buffer in the lower fluid cell beneath the nanopore, ensuring there are no bubbles present that may affect the measurement.Now click the upper fluid cell into place and add 40 microliters of buffer, ensuring there are no bubbles present. Then place a faraday cage over the system and apply an external pressure as described in the text protocol. After placing 40 microliters of the calibration particles into the upper fluid cell, complete a TRPS measurement at three applied voltages.Alter the voltage by clicking on the plus and minus buttons on the voltage scale in the instrument settings tab in the software. Check that the three voltages return the appropriate background currents. And ensure that at the medium voltage, the calibration particles produce an average blockade magnitude of at least 0.3 nanoamperes.Once the conditions outlined in the text protocol have been achieved, start the run by clicking start in the software in the data acquisition tab. To complete the measurement, click stop in the data acquisition tab and save the data file. Wash the system by replacing the calibration particles with 40 microliters with PBST buffer into the upper fluid cells several times.And applying various pressures until no more blockade events are present, ensuring there are no residual particles and no cross contamination. After the appropriate baseline current is achieved, replace the electrolyte in the upper fluid cell with 40 microliters of sample. Start the sample run by clicking start in the data acquisition tab.Record a minimum of 500 particles and ensure the run time is a minimum of 30 seconds. To complete the measurement, click stop in the data acquisition tab and save the data file. An example of size and zeta potential analysis of streptavidin coated particles with no modifications and streptavidin coated particles saturated with single stranded DNA on the surface is shown here.Although both samples were of a similar size, the zeta potential was significantly different and much larger when DNA was functionalized onto the particle surface. The size and zeta potential data exhibited for samples with the lowest an highest concentrations of DNA hybridized to the streptavidin coated particles is displayed here. A larger zeta potential value is recorded for particles hybridized with a higher concentration of DNA.The change in zeta potential measured for capture probed DNA only, a fully complementary DNA target, a middle binding DNA target, an end binding DNA target, and an overhanging DNA target is shown here. Once mastered, this technique can be done in 20 minutes if it is performed properly. While attempting this procedure it's important to remember to thoroughly wash a nanopole between each calibration and sample to ensure there is no cross contamination between samples and prevent any nanopole blocking.After its development, this technique paved the way for researchers in the field of biosenses to explore protein-protein and protein-DNA interactions in multiplex assays. After watching this video you should have a good understanding of how to obtain zeta potential using TRPS and prepare DNA modified particles for bioassays.

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

Kontrast Ultrason Gliomlar, Tedavi Hedeflenen İlaç-Rulman Nanopartikül Teslimat ve Mikrovasküler Ablasyon ile Fare

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

Biyomühendislik

A Microfluidic-based Hydrodynamic Trap for Single Particles

Tek Parçacıklar için mikroakışkan tabanlı Hidrodinamik Tuzak

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Sayımı ve Ayarlanabilir Dirençli Darbe Algılama Yöntemi Ekstrasellüler Veziküller boyutu-profil

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

Bir mikroakışkan Hassas Küçük hacimli Numune İşleme Platformu ve Akustik mikrocihazda Ayrı Biyolojik Parçacıklar Boyutu Kullanımı

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Şeffaf olmayan iskelelerinin üzerinde Görüntüleme Hücre Canlılık - Roman Örme Titanyum İmplant Örnek Kullanımı

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

3D Hücre Kültürü için Pulmoner Ekstrasellüler Matrix Ayarlanabilir Hidrojellerinin

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Parçacıkların Mekansal Takip için Çoklanmış Elektronik Algılama ile mikroakışkan Platformu

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

Wavefront Şekillendirme kullanarak bir Fiber Optik aracılığıyla Çoklu Sinyalleri İletim

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...

An Integrated System to Remotely Trigger Intracellular Signal Transduction by Upconversion Nanoparticle-mediated Kinase Photoactivation

Hücre içi sinyal iletimi Upconversion nanopartikül aracılı kinaz Photoactivation tarafından uzaktan tetiklemek için entegre bir sistem

Upconversion nanoparticle (UCNP)-mediated photoactivation is a new approach to remotely control bioeffectors with much less phototoxicity and with deeper ...