Name: measurement of in vitro integration activity of hiv-1 preintegration complexes
Uploaded: 2017-02-22T12:30:00
Description: Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Dette arbejde er delvist støttet af tilskud DA024558, DA30896, DA033892, og DA021471 fra Nida / NIH til CD. Vi anerkender også RCMI tilskud G12MD007586, Vanderbilt CTSA give UL1RR024975, den Meharry Translationel Research Center (MeTRC) CTSA tilskud U54 RR026140 fra NCRR / NIH, at U54 tilskud MD007593 fra NIMHD / NIH, og Tennessee CFAR tilskud P30 AI110527.

1. Virus Production BEMÆRK: For at generere høje titre af infektiøs HIV-1, transficere humane embryoniske nyre (HEK) cellelinie 293T med en infektiøs HIV-1 molekylære klon ved anvendelse af en aktiveret dendrimer-baserede transfektionsreagens. Det er blevet observeret, at calciumphosphat-transfektion metode giver sammenlignelige resultater. <ol><li> I en biosikkerhedsniveau 2 (BSL2) lab, frø 3 x 10 6 293T celler pr 10 cm skål i 8 ml Dulbeccos Modified Eagle Medium (DMEM) ...

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

Biokemiske analyser af retrovirale PIC&#39;er har givet kritiske indsigt i mekanismen for retroviral DNA-integration. Måling af integration aktivitet af retrovirale PIC&#39;er kan opnås ved plakdannelse assay Southern blot-analyse, og nested qPCR. Den eksperimentelle strategi af plak-assay er besværlig og udnytter en indirekte metode til måling af integration 6, 7, 18. Southern blot assays foranstaltning integration direkte...

HIV-1-replikation i målcellen involverer flere trin, generelt inddeles i to faser: tidlige og sene begivenheder. De tidlige begivenheder begynder, når HIV-1 sekventielt binder til målet celleoverfladereceptoren CD4 og en af de to co-receptorer (CCR5 eller CXCR4) 1. Følgelig virus-celle membraner lunte, og det virale capsid (CA) kerne frigives til cytoplasmaet 2. CA kerne indeholder det virale genomiske enkeltstrenget RNA (ssRNA) og adskillige proteiner, både virale og cellulære oprindelse. Ca-associerede virale proteiner indbefatter revers transkriptase (RT) og integrase (IN), to enzymer, der medierer kritiske trin i de tidlige begivenheder i virusreplikation. RT og IN-funktionen i forbindelse med nukleoprotein komplekser, nemlig revers transkription Complex (RTC) og præ-integration komplekset (PIC), henholdsvis 3, 4, 5 &lt;sup&gt;, 6. Enderne af det virale genom ssRNA harbour terminale gentagelse (R) elementer støder op til de unikke sekvenser U5 (ved 5&#39;-enden) og U3 (ved 3 &#39;enden). RTC konverterer det virale ssRNA genomet i en dobbeltstrenget (ds) DNA-kopi (vDNA). Denne revers transkription proces resulterer også i overlapning af U5 og U3 sekvenser, hvorved der genereres lange terminale gentagelser (LTR) ved begge ender af vDNA 7, 8. Efterfølgende PIC-associerede IN katalyserer to sekventielle biokemiske reaktioner, der muliggør integrationen af vDNA i værtskromosomet 9, 10, 11. Først, i cytoplasmaet, IN multimerer engagere både LTR&#39;er 12 og spalte en dinukleotid fra hver af de 3&#39;-terminale ender. Dette 3&#39;-end behandling genererer en hydroxylgruppe ved hver 3&#39;-ende (CA OH) i vDNA.Dernæst PIC trafikker til kernen, hvor i anvender vDNA CA OH som en nukleofil til at skære begge strenge af det kromosomale DNA i en forskudt måde. Samtidig IN splejsninger koordineret begge ender af vDNA til de resulterende phosphodiesterbindinger på modsatte strenge af det kromosomale DNA. Efter denne streng transfer trin, værtscellen maskiner fjerner to uparrede nukleotider i 5&#39;enderne af vDNA og reparationer de følgende enkeltstrengede huller ved krydset af integrationen site. De tidlige begivenheder således kulminere med etableringen af ​​et integreret DNA-kopi (provirus) af HIV-1-genomet. Proviruset tilvejebringer et egnet miljø for effektiv viral genekspression, som initierer senere begivenheder, herunder ekspressionen af ​​virus-kodede proteiner; samling af umodne virus; og spirende, frigivelse, og modning i infektiøse viruspartikler 13. Renset rekombinant retroviral IN er kompetent til atudføre, in vitro, både 3&#39;-end forarbejdning og streng transferaktiviteter på eksogent leveret LTR-lignende substrat DNA. Biokemiske undersøgelser under anvendelse sådan oprenset rekombinant IN har afsløret kritiske aspekter af vDNA integration 14, 15, 16, 17. Men i modsætning til i naturlig infektion, dette in vitro biokemisk reaktion understøtter ikke samordnede integration af begge ender af substrat-DNA ind i mål-DNA. I modsætning hertil retrovirale PIC&#39;er isoleret fra akut inficerede celler samordnet for at integrere begge ender af det endogene vDNA til heterolog mål-DNA. Dette førte til udbredt anvendelse og efterfølgende justeringer af I n Vitro Integration (IVI) analyser ved hjælp isolerede indfødte ansvarlige. I den første rapporterede retrovirale IVI assay cytoplasmatiske ekstrakter fra celler inficeret med en rekombinant murinLeukæmi Virus (MLV) huser E. coli supF-genet i sin LTR tjent som kilden til IN-aktivitet, og DNA&#39;et af en mutant lambda-fag defekt i lytisk vækst blev eksogent leveret som target-DNA&#39;et. Vellykket integration af det rekombinante MLV DNA kopiere, i fag-DNA&#39;et og den efterfølgende supF ekspression førte til restaurering af plaque-dannende evne af de rekombinante fager. Men denne eksperimentelle strategi er besværlig og foranstaltninger integration på en indirekte måde. For at imødegå sådanne forbehold, blev en Southern blot-baserede indirekte ende-mærkning assay, der kvantificerer PIC-associerede IVI aktivitet som et mål for den endogene vDNA integreret i eksogen lineariserede bakteriofag phiX174 DNA, udviklet 6, 7, 18. Selv om denne metode giver et direkte mål for integration begivenheder, er relativt høje mængder af PIC forberedelse kræves, som stadig er et teknisk udfordrendebestræbelse. For at omgå dette, blev indlejrede PCR-baserede analyser, der kræver kun beskedne mængder af PIC&#39;er udviklet 4, 5, 19. I denne rapport beskriver vi en opdateret version af et nested PCR-baserede in vitro-metode udviklet til at rekapitulere HIV-1 PIC-medieret integration aktivitet forekommer under naturlig infektion. Denne metode anvender cytoplasmatiske ekstrakter af HIV-1-inficerede målceller som en kilde til endogen PIC-aktivitet, som måles med en real-time kvantitativ polymerasekædereaktion (qPCR). Procedurerne for at isolere ansvarlige og måle deres integrationsaktiviteter tilpasses, med modifikationer, fra protokoller offentliggjort af Engelman laboratoriet 20. Ved denne fremgangsmåde er PIC-associerede integration aktivitet initieres ved at tilvejebringe en eksogen lineær mål-DNA 21, og DNA, der stammer fradenne integration reaktion oprenses og anvendes som udgangsmateriale til efterfølgende PCR-baserede kvantificering. I første runde konventionel PCR er de virale-mål-DNA junctions amplificeret ved anvendelse af passende primere. I anden runde qPCR, er LTR-specifikke primere anvendes til specifikt at berige vDNA befolkning fra første runde PCR-produkter. Se afsnittet protokol for en detaljeret beskrivelse af denne metode. In vitro studier med retrovirale ansvarlige har ført til betydelige fremskridt i vores forståelse af mekanismen for retroviral DNA integration og i udviklingen af IN-hæmmere. Baseret på den seneste øget fokus på kortlægning af HIV-1 integration sites, bestemme rolle af virale og vært faktorer i HIV-1 integration, og udvikle nye antivirale lægemidler til bekæmpelse af resistens, vi forestiller en øget interesse i og udbredt brug af IVI assays , som den er beskrevet i denne rapport. Dette vil igen, vil føre tilfremtidige forbedringer i metoden, og dermed diversificere omfanget af dets applikationer.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1-kappeproteiner engagere beslægtede receptorer på målcellen overflade, hvilket fører til viral-cellemembranen fusion efterfulgt af frigivelsen af ​​det virale capsid (CA) kerne ind i cytoplasmaet. Efterfølgende den virale reverse transkriptase (RT), som en del af en navnebror nukleoprotein kompleks betegnes revers transkription Complex (RTC), konverterer det virale enkeltstrenget RNA-genom ind i en dobbeltstrenget DNA-kopi (vDNA). Dette fører til biogenesen af ​​anden nukleoprotein kompleks, betegnet præ-integration komplekset (PIC), sammensat af vDNA og associerede virusproteiner og vært faktorer. PIC-associeret viral integrase (IN) orchestrates integrering af vDNA i værtens kromosomale DNA i en tidsmæssigt og rumligt reguleret totrinsproces. For det første har i processer 3&#39;-enderne af vDNA i cytoplasmaet, dels efter PIC trafikker til kernen, den medierer integration af det forarbejdede vDNA i det kromosomale DNA. De ansvarlige isoleretfra målceller akut inficeret med HIV-1 er funktionelle in vitro, da de er kompetente til at integrere den tilknyttede vDNA til et exogent tilsat heterologt mål-DNA. En sådan PIC-baserede in vitro integration analyser har bidraget væsentligt til at afgrænse de mekanistiske detaljer i retroviral integration og til at opdage IN hæmmere. I denne rapport, vi uddybe en opdateret HIV-1 PIC assay, der anvender en indlejret real-time kvantitativ polymerasekædereaktion (qPCR) -baseret strategi til måling af in vitro-integration aktivitet af isolerede indfødte ansvarlige.

Isolering af HIV-1-PIC&#39;er En skematisk af den anvendte protokol til isolering af HIV-1-PIC&#39;er fra akut inficerede Sup-T1-celler er afbildet i figur 1. Denne protokol er afledt af fremgangsmåderne beskrevet af Engelman et al. 19, 20. HIV-1-PIC&#39;er er nukleoprotein komplekser, der er samlet i inficerede celler og er ...

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

måling af<em&gt; In vitro</em&gt; Integration aktivitet af HIV-1 Preintegration komplekser

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

In vitro Uncoating of HIV-1 Cores

In vitro Uncoating of HIV-1 Cores

In vitro Uncoating af HIV-1 kerner

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Scanning af HIV-1 Envelope-induceret Virologisk Synapse og signaler på syntetiske lipiddobbeltlagenes

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

En<em&gt; In vitro</em&gt; Samtidig infektion model for at studere<em&gt; Plasmodium falciparum</em&gt;-HIV-1 Interactions i humane primære Monocytafledte immunceller

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

Et restriktionsenzym Baseret Kloning metode til at vurdere den<em&gt; In vitro</em&gt; Replikationskapacitet af HIV-1 subtype C Gag-MJ4 Kimære Vira

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

Konformationel Evaluering af HIV-1 trimere kappeglycoproteinerne hjælp af en celle-ELISA-assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Isolering af Exosomer fra plasma af HIV-1 Positive Personer

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

Visualisering af HIV-1 Gag binding til Giant unilamellare vesikel (GUV) Membraner

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluering af effekt og toksicitet af RNA Målretning HIV-1 Produktion til brug i Gene eller Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...