Name: the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics
Uploaded: 2016-10-06T14:00:00
Description: Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

LET OP: Dit werk maakt gebruik van de eyFLP1; handeling&gt; y +&gt; Gal4, UAS-GFP; FRT82B, bad-GAL80 MARCM 82B Green tester lijn 11. De oversteek van de MARCM 82B Green tester maagden om mannetjes van stammen zoals w; UAS-a; UAS-RNAi b, c FRT82B mut genotype zal nageslacht waarin mitotische recombinatie zal optreden tussen de rechter armen van de 3 e homologe chromosomen opleveren. Zo zal klonen homozygoot mutant gen c distaal aan de FRT82B plaats binnen de he...

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

De technieken voor het genereren van genetische mozaïeken in Drosophila behoren tot de meest verfijnde hulpmiddelen voor het analyseren en manipuleren genfunctie 33. De eyFLP-MARCM systeem heeft bewezen krachtig en robuust als het laat de inductie van visueel gemarkeerd, genetisch bepaald klonen in een ruimtelijk beperkte wijze, dat wil zeggen, in de weefsels waar de eyeless enhancer actief is 9,18. Dit is vooral belangrijk wanneer meerdere genetische laesies worden geco...

Kanker is een van de meest genetisch heterogene groep van ziekten, waarvan de incidentie en sterfte neemt drastisch toe, vooral onder ouderen wereldwijd. Cancer afkomstig klonaal uit een tumor-initiërende cel die inherent tumor suppressor mechanismen ontsnapt en verdeelt uit de hand. De geleidelijke toename van de genetische laesies die gezamenlijk het stimuleren van groei, proliferatie en de beweeglijkheid, terwijl het remmen van de dood en differentiatie transformeert de eerste goedaardige begroeiing in een zeer kwaadaardige, metastatische en dodelijke tumor. Gebleken is dat naast genetische veranderingen, tumorprogressie veranderingen nodig in de omliggende stroma en overspraak tussen tumortypes en verschillende celtypes (bijvoorbeeld fibroblasten, immuun- en endotheelcellen) in de micro-omgeving. Het begrijpen van de moleculaire principes die ten grondslag liggen kwaadaardige transformatie, inclusief de tumor-stroma interacties is van groot belang voor de ontwikkeling van Preventie en vroege screeningsstrategieën, alsmede nieuwe en effectieve behandelingen voor kanker en metastase geneesmiddelresistentie bestrijden. De fruitvlieg Drosophila melanogaster is een aantrekkelijk systeem voor kankeronderzoek 1-4 dankzij zijn snelle generatie tijd geworden, opmerkelijke behoud van de signalering knooppunten tussen vliegen en de mens, beperkte genetische redundantie en de rijkdom van geavanceerde genetische tools die manipulatie van bijna elk gen in te vergemakkelijken een tijdelijk en ruimtelijk beperkte wijze. Genetische gedefinieerde tumoren van verschillende maligniteit kan reproduceerbaar worden gemanipuleerd in Drosophila door de invoering gain en verlies-van-functie mutaties in een subset van voorlopercellen in een overigens wildtype weefsel met behulp van de techniek MARCM 5. De MARCM gereedschap combineert FLP / FRT (FLP recombinase / FLP Erkenning Target) gemedieerde mitotische recombinatie 6 met FLP-out 7 en Gal4 / UAS (Upstream Activation Sequence) 8 doelwit genexpressiesystemen 9. Met deze werkwijze expressie van een-UAS gebaseerde transgene, waaronder oncogeen of fluorescerend eiwit cDNA&#39;s of geïnverteerde DNA repeats voor dsRNA-geïnduceerde genuitschakeling, wordt beperkt tot een kloon van cellen die een specifieke genetische locus en een Gal4 repressor door recombinatie verloren (Figuur 1A). Klonen plekken gemarkeerd met green fluorescent (GFP) of rood fluorescerende eiwitten (bijvoorbeeld, RFP, DsRed, mCherry) kan eenvoudig worden gevolgd tijdens de ontwikkeling, geïsoleerd en geanalyseerd. Belangrijker is dat hun gedrag rechtstreeks vergeleken met de aangrenzende wildtype weefsel. Zo vragen relevant zijn voor de cel autonome als niet-autonome effecten van genetische laesies kunnen gemakkelijk worden bestudeerd. Soortgelijke zoogdieren, alleen klonen waarin meerdere oncogene laesies combined maligne Drosophila worden en herhalen belangrijkste kenmerken van kankercellen van een zoogdier. Ze overproliferate, ontwijken apoptose, induceren ontsteking, onsterfelijk en Invasive uiteindelijk het doden van de gastheer 10-17. Hier beschrijven we een protocol om genetisch bepaald klonale tumoren in het oog / antennaal en hersenweefsel van Drosophila larven te genereren met behulp van de MARCM techniek. De werkwijze berust op een MARCM tester materieel dat de gist FLP recombinase onder de controle van de enhancer ogenloze (eyFLP) 18,19 uitdrukt. Op deze wijze worden gemerkt GFP klonen gegenereerd in zowel peripodial en cilindrisch epitheel van de EAD en neuro-epitheel van de hersenen tijdens de embryonale en larvale stadia (Figuur 1A, B en referentie 20). Klonen kunnen eenvoudig worden gevolgd tot volwassenheid als EAD zich ontwikkelt tot de volwassen oog, antenne en het hoofd capsule, terwijl de neuroepithelium aanleiding geeft tot neuroblasts dat gedifferentieerde optische kwab neuronen produceren. Uitgebreide moleculaire, functionele en fenotypische karakterisering van het mozaïek weefsel, we de te vergemakkelijkenschrijver een protocol voor dissectie van de EAD en hersenen van de derde instar larven en een beschrijving te verwerken voor drie verschillende toepassingen: (i) het opsporen van transgene fluorescente reporters en immunokleuring, (ii) kwantificering van tumor invasiviteit en (iii) analyse van genexpressie verandert met een kwantitatieve real-time PCR (qRT-PCR) of high-throughput sequentiebepaling mRNA (mRNA-seq) (Figuur 1C). De immunokleuring protocol kan worden gebruikt om een ​​eiwit van belang te visualiseren met een specifiek antilichaam. Transgene fluorescerende transcriptionele reporters bieden handige en nauwkeurige tijdruimtelijke gegevens over de activiteit van een bepaalde signaleringsroute. Cel-afstammingslijn specifieke reporters, anderzijds, tijdens kwalitatieve en kwantitatieve veranderingen in celpopulaties binnen de mozaïek weefsel en bij tumoren van verschillende genotypes. Kwantificering van invasieve gedrag maakt de vergelijking van tumor maligniteit tussen genotypes. Ten slotte is het protocol beschrijft inzameling en verwerking van mozaïek EAD voor RNA-isolatie is geschikt voor zowel kleine als grote schaal downstream-toepassingen zoals reverse transcriptie gevolgd door qRT-PCR en genoom-brede mRNA-seq, respectievelijk. De kwalitatieve en kwantitatieve gegevens verkregen uit deze testen leveren nieuwe inzichten in het sociale gedrag van klonale tumoren. Bovendien produceren ze een solide basis voor functionele studies over de rol van individuele genen, genetische netwerken en tumor micro-omgeving in verschillende stadia en aspecten van tumorigenese.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Om het potentieel van de eyFLP-MARCM techniek om GFP gemerkt stukken gedefinieerde genotypen in Drosophila EAD genereren demonstreren, werden drie klonen geïnduceerd: (1) controle expressie alleen GFP, (2) maligne tumoren tot expressie een oncogene vorm van de kleine G-proteïne Ras (Ras V12) in een achtergrond van homozygote verlies van een tumorsuppressorgen scribble (Scrib 1) en (3) begroeiing maar niet-invasieve ras V12...

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Dit protocol laat zien hoe fluorescent gemerkt, genetisch bepaald klonale tumoren in de Drosophila oog / antennaal verbeelding schijven (EAD) te genereren. Het beschrijft hoe de EAD en de hersenen ontleden van de derde instar larven en hoe ze te verwerken te visualiseren en te kwantificeren genexpressie veranderingen en tumor invasiviteit.

De<em&gt; Drosophila</em&gt; Imaginal Disc Tumor Model: visualisatie en kwantificering van genexpressie en Tumor Invasiviteit met behulp van genetische Mozaïeken

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

Een muizen orthotope Blaas Tumor Model en Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Inductie en diagnose van tumoren in<em&gt; Drosophila</em&gt; Imaginal Disc Epithelia

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

Voorwaardelijke Knockdown van genexpressie in kanker cellijnen te bestuderen van de aanwerving van monocyten/macrofagen naar de Tumor communicatie

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

De oprichting van een Long kolonisatie Assay voor het circulerende Tumor visualisatie van de cel in de weefsels van de longen

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Radionuclide-fluorescentie Reporter Gene Imaging als u wilt bijhouden van de Tumor progressie in knaagdier Tumor modellen

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

Acellulair en cellulaire Lung Model studie Tumor uitzaaiingen

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

Digitale Polymerase Chain Reaction Assay voor de genetische variatie in een sporadische familiale adenomateuze Polyposis patiënt met behulp van de Chip-in-a-tube-indeling

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Onderzoek naar genetische afhankelijkheden met behulp van CRISPR-Cas9-concurrentie op basis van testen

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

De klinische toepassing van Tumor velden therapie behandelen in Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...