Name: the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics
Uploaded: 2016-10-06T14:00:00
Description: Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

NOTE: Ce travail utilise le eyFLP1; acte&gt; y +&gt; Gal4, UAS-GFP; FRT82B, baignoire-GAL80 marcm 82B ligne verte testeur 11. Traversant les marcm 82B verts testeur vierges aux mâles de souches telles que w; UAS-a; UAS-b ARNi, FRT82B c mut génotype donnera une descendance dans laquelle la recombinaison mitotique se produira entre le bras droit de la 3 ème chromosomes homologues. De cette manière, les clones mutants homozygotes pour le gène c situé distal...

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

Les techniques pour générer des mosaïques génétiques chez la drosophile sont parmi les outils les plus sophistiqués pour l&#39; analyse et la manipulation de la fonction des gènes 33. Le système eyFLP-marcm a prouvé puissant et robuste , car elle permet l&#39;induction de marqués visuellement, clones génétiquement définis d&#39;une manière spatialement restreinte, à savoir, dans les tissus où l&#39;activateur eyeless est actif 9,18. Ceci est particulièrem...

Le cancer représente l&#39;un des groupes les plus génétiquement hétérogène de maladies, dont l&#39;incidence et la mortalité est considérablement augmenter, en particulier chez les personnes âgées dans le monde entier. Le cancer provient clonale d&#39;une cellule tumorale initiatrice qui échappe des mécanismes suppresseurs de tumeur inhérente et se divise hors de contrôle. L&#39;accumulation progressive de lésions génétiques qui favorisent la collaboration la croissance, la prolifération et la motilité tout en inhibant la mort et la différenciation transforme la surcroissance bénigne initiale dans une tumeur très maligne, métastatique et mortelle. Il est devenu évident qu&#39;en plus des altérations génétiques, la progression de la tumeur nécessite des changements dans le stroma environnant et la diaphonie entre les types de cellules tumorales et de multiples (par exemple, des fibroblastes et des cellules immunitaires endothéliales) dans son micro - environnement. Comprendre les principes moléculaires sous-jacents, y compris la transformation maligne interactions tumeur-stroma est d&#39;une grande importance pour le développement de prévention et le dépistage précoce des stratégies, ainsi que des traitements nouveaux et efficaces pour lutter contre les métastases du cancer et de la résistance aux médicaments. La mouche des fruits Drosophila melanogaster est devenu un système attrayant pour la recherche sur le cancer 1-4 en raison de son temps de génération rapide, remarquable conservation des noeuds entre les mouches et les humains, la redondance génétique limitée et la richesse des outils génétiques avancées qui facilitent la manipulation de presque tout gène dans la signalisation d&#39;une manière temporaire et dans l&#39;espace restreint. Les tumeurs génétiquement définies de malignité variable peuvent être conçus de façon reproductible chez la drosophile en introduisant des mutations perte et intensité forte de fonction dans un sous - ensemble de progéniteurs dans un tissu de type sauvage par ailleurs en utilisant la technique de 5 marcm. L&#39;outil de marcm combine FLP / FRT (FLP recombinase / FLP Reconnaissance cible) médiée recombinaison mitotique 6 avec FLP-out 7 et Gal4 / UAS (Upstream Activation Séquence) gène 8 cibleLes systèmes d&#39;expression 9. Avec cette méthode, l&#39;expression d&#39;un transgène à base UAS, y compris oncogène ou des ADNc de protéines fluorescentes ou répétitions d&#39;ADN inversées pour le silençage génique ARNdb-induite, sera limitée à un clone de cellules qui ont perdu un locus génétique spécifique et un répresseur Gal4 due à la recombinaison (figure 1A). Patches clonales marqués avec fluorescente verte (GFP) ou des protéines fluorescentes rouges (par exemple, RFP, DsRed, mCherry) peut facilement être suivis tout au long du développement, isolé et analysé. Surtout, leur comportement peut être comparé directement au tissu adjacent sauvage de type. Ainsi, des questions pertinentes à la cellule des effets autonomes et non autonomes de lésions génétiques peuvent être facilement étudiées. Comme pour les mammifères, seuls clones dans lesquels de multiples lésions oncogéniques sont combinés deviennent malignes chez la drosophile et récapitulent caractéristiques clés du cancer chez les mammifères. Ils overproliferate, échapper à l&#39;apoptose, provoquer l&#39;inflammation, devenir immortel et Invasive, finalement tuer l&#39;hôte 10-17. Ici, nous décrivons un protocole pour générer des tumeurs clonales génétiquement définies dans le tissu oculaire / antennaire et le cerveau des larves de drosophile en utilisant la technique de marcm. La méthode repose sur un testeur de stock marcm qui exprime la levure FLP recombinase sous le contrôle de l&#39;amplificateur eyeless (eyFLP) 18,19. De cette manière, les clones GFP marquées sont générées à la fois dans l&#39; épithélium cylindrique peripodial et de l&#39;EAD et le neuroépithélium du cerveau à travers les stades embryonnaire et larvaire (figure 1A, B et référence 20). Les clones peuvent être facilement suivis jusqu&#39;à l&#39;âge adulte que l&#39;EAD se développe dans l&#39;œil adulte, l&#39;antenne et la tête tandis que la capsule neuroepithelium donne lieu à des neuroblastes qui produisent des neurones du lobe optique différenciés. Pour faciliter une caractérisation moléculaire, fonctionnelle et phénotypique du tissu mosaïque, nous describe un protocole pour la dissection de l&#39;EAD et le cerveau à partir du troisième stade larvaire et décrire la façon de les traiter pour les trois applications différentes: (i) la détection des reporters fluorescents transgéniques et immunomarquage, (ii) la quantification de l&#39;invasivité de la tumeur et (iii) l&#39;analyse des modifie l&#39; expression du gène en utilisant une PCR quantitative en temps réel (qRT-PCR) ou d&#39; un ARNm de séquençage à haut débit (ARNm-seq) (figure 1C). Le protocole d&#39;immunocoloration peut être utilisé pour visualiser toute protéine d&#39;intérêt avec un anticorps spécifique. Transgenic reporters de transcription fluorescentes fournissent des informations spatiotemporelle pratique et précise sur l&#39;activité d&#39;une voie de signalisation particulière. journalistes spécifiques Cell-lignage, d&#39;autre part, tenir compte des changements qualitatifs et quantitatifs dans les populations de cellules dans le tissu mosaïque et parmi les tumeurs de génotypes distincts. Quantification de comportement invasif facilite la comparaison de malignité de la tumeur entre le génotypes. Enfin, le protocole décrivant la collecte et le traitement de l&#39;EAD mosaïque pour l&#39;isolement de l&#39;ARN est adapté pour les applications en aval petite et à grande échelle tels que la transcription inverse suivie par qRT-PCR et pangénomique ARNm-seq, respectivement. Les données qualitatives et quantitatives obtenues à partir de ces essais fournissent de nouveaux aperçus sur le comportement social des tumeurs clonales. De plus, ils produisent une base solide pour des études fonctionnelles sur le rôle des gènes individuels, des réseaux génétiques et microenvironnement de la tumeur dans les différentes étapes et les aspects de la tumorigenèse.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Pour démontrer le potentiel de la technique eyFLP-marcm pour générer des correctifs de GFP marquée de génotypes définis dans la drosophile EAD, trois types de clones ont été induits: (1) le contrôle GFP exprimant seulement, (2) les tumeurs malignes exprimant une forme oncogénique de la petite G-protéine Ras (Ras V12) dans un contexte de perte homozygote d&#39;un gribouillis de gène suppresseur de tumeur (Scrib 1), et (3) surcro...

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Ce protocole montre comment générer des tumeurs clonales marquée par fluorescence, génétiquement définis dans l&#39;œil de Drosophila / disques imaginaux antennaires (EAD). Il décrit comment disséquer l&#39;EAD et le cerveau à partir du troisième stade larvaire et comment les traiter pour visualiser et quantifier les changements d&#39;expression des gènes et l&#39;invasivité des tumeurs.

le<em&gt; Drosophila</em&gt; Imaginal Tumor Disc Modèle: Visualisation et quantification de l&#39;expression génique et de tumeurs invasives utilisant Mosaïques génétique

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

Un système de détection de tumeur modèle et tumeur murine Orthotopique vessie

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Recherche

Recherche en cancérologie

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induction et diagnostic des tumeurs dans<em&gt; Drosophila</em&gt; Imaginal Disc Epithelia

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

Knockdown conditionnel de l’Expression génique dans les lignées de cellules cancéreuses pour étudier le recrutement des Monocytes/Macrophages pour le microenvironnement tumoral

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

La mise en place d’un essai de colonisation poumon pour la visualisation de cellules de tumeur dans les tissus pulmonaires en circulation

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Gène rapporteur de radionucléide-fluorescence Imaging pour suivre la Progression tumorale dans les modèles de rongeurs tumeur

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

Cellulaire et acellulaire poumon modèle pour étudier les métastases tumorales

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

Digital Polymerase Chain Reaction Assay for la Variation génétique chez un Patient sporadiques de la polypose adénomateuse familiale en utilisant le Format de puce-in-a-tube

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Enquête de dépendances génétiques utilisant la concurrence fondée sur les Cas9-CRISPR

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

L’Application clinique de la tumeur, traitement de thérapie de champs dans le glioblastome

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...