Name: the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics
Uploaded: 2016-10-06T14:00:00
Description: Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

NOTA: Este trabalho utiliza o eyFLP1; act&gt; y +&gt; Gal4, UAS-GFP; Linha tester FRT82B, banheira-Gal80 marcm 82B Verde 11. Cruzando as virgens testador marcm 82B Verdes para machos de estirpes tais como w; UAS-um; UAS-b RNAi, FRT82B c mut genótipo irá produzir descendência em que a recombinação mitótico irá ocorrer entre os braços direitos dos cromossomos homólogos 3º. Desta forma, os clones mutante homozigótica para o gene c localizada d...

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

As técnicas para gerar mosaicos genéticos em Drosophila estão entre as ferramentas mais sofisticadas para analisar e manipular a função do gene 33. O sistema eyFLP-marcm provou poderoso e robusto, uma vez que permite a indução do visualmente marcados, clones geneticamente definidas de uma maneira espacialmente restrita, isto é, em tecidos em que o potenciador é activa sem olhos 9,18. Isto é particularmente importante quando múltiplas lesões genéticas são com...

Cancer representa um dos grupo mais geneticamente heterogêneo de doenças, cuja incidência e mortalidade está aumentando dramaticamente, especialmente entre os idosos em todo o mundo. Cancer origem clonal de uma célula de iniciação tumor que escapa mecanismos supressores tumorais inerente e divide fora de controle. A acumulação gradual de lesões genéticas que cooperativamente promover o crescimento, a proliferação e a motilidade, enquanto inibir a morte e a diferenciação transforma o crescimento excessivo benigno inicial em um tumor altamente maligno metastático e mortal. Tornou-se evidente que, além de alterações genéticas, a progressão do tumor requer alterações no estroma circundante e diafonia entre os tipos de células tumorais e múltiplos (por exemplo, fibroblastos, células endoteliais, imunes e) no seu microambiente. Compreender os princípios moleculares subjacentes transformação maligna incluindo interações tumor-estroma é de grande importância para o desenvolvimento de prevenestratégias de e rastreio precoce, bem como tratamentos novos e eficazes para lutar contra a metástase do câncer e resistência aos medicamentos. A mosca da fruta Drosophila melanogaster tornou-se um sistema atraente para a investigação do cancro 1-4 devido ao seu tempo de geração rápido, notável conservação da sinalização nós entre moscas e seres humanos, redundância genética limitada e riqueza de ferramentas genéticas avançadas que facilitam a manipulação de quase qualquer gene em de maneira temporária e espacialmente restritos. Tumores geneticamente definidas de diferentes malignidade pode ser reprodutivelmente engenharia em Drosophila através da introdução de gain- e mutações de perda de função em um subconjunto de células progenitoras num tecido de outra forma tipo selvagem utilizando a técnica marcm 5. A ferramenta combina marcm FLP / FRT (FLP recombinase / FLP Reconhecimento Target) mediada por recombinação mitótica 6 com FLP-out 7 e Gal4 / UAS (Upstream Activation Sequence) gene alvo 8sistemas de expressão de 9. Com esta expressão método de qualquer transgene UAS-base, incluindo oncogene ou ADNc de proteína fluorescente ou repetições de ADN invertidos para silenciamento de genes induzido por ARNcd, será restrita a um clone de células que perderam um locus genético específico e um repressor Gal4 devido à recombinação (Figura 1A). Remendos clonais marcados com fluorescente verde (GFP) ou proteínas fluorescentes vermelho (por exemplo, RFP, DsRed, mCherry) pode ser facilmente rastreada ao longo do desenvolvimento, isolados e analisados. Importantemente, o seu comportamento pode ser directamente comparada com o tecido adjacente de tipo selvagem. Assim, questões pertinentes à célula efeitos autónomos e não autónomos de lesões genéticas podem ser convenientemente estudado. Semelhante a mamíferos, apenas clones em que múltiplas lesões oncogênicos são combinados se tornem malignas em Drosophila e recapitular características principais de câncer de mamíferos. Eles overproliferate, fugir apoptose, induzir a inflamação, tornar-se imortal e invasiva, em última análise, matando o hospedeiro 10-17. Aqui, descrevemos um protocolo para gerar tumores clonais geneticamente definidas no tecido ocular / antenas e do cérebro de larvas de Drosophila usando a técnica marcm. O método baseia-se um testador de estoque marcm que expressa a recombinase FLP de levedura sob o controlo do intensificador sem olhos (eyFLP) 18,19. Desta forma, os clones marcado com GFP são geradas em ambos epitélio colunar e peripodial do EAD e o neuroepitélio do cérebro ao longo estágios embrionários e larval (Figura 1a, b e de referência 20). Clones podem ser facilmente seguido até a idade adulta como a EAD desenvolve no olho adulto, antena e cabeça cápsula enquanto o neuroepitélio dá origem a neuroblastos que produzem neurônios do lóbulo óptica diferenciadas. Para facilitar a extensa caracterização molecular, funcional e fenotípica do tecido mosaico, que deescriba um protocolo para dissecção da EAD e do cérebro a partir do terceiro larvas e delinear a forma de processá-los por três aplicações diferentes: (i) a detecção de repórteres fluorescentes transgênicas e imunocoloração, (ii) quantificação de invasão tumoral e (iii) a análise dos altera a expressão do gene utilizando uma quantitativa PCR em tempo real (qRT-PCR), ou um ARNm de alto rendimento de sequenciação (ARNm-SEQ) (Figura 1C). O protocolo de imunocoloração pode ser usado para visualizar qualquer proteína de interesse com um anticorpo específico. Transgenic repórteres fluorescentes transcricionais fornecer informações espaço-temporal conveniente e precisa sobre a actividade de uma via de sinalização particular. repórteres celular específicos de linhagem, por outro lado, reflectem alterações qualitativas e quantitativas em populações de células no interior do tecido do mosaico e entre os tumores de diferentes genótipos. A quantificação do comportamento invasivo facilita a comparação de malignidade do tumor entre o genótipos. Finalmente, o protocolo descrevendo recolha e tratamento de EAD mosaico para o isolamento de RNA é adequado tanto para aplicações a jusante-pequena e grande escala, tais como a transcrição reversa seguida de qRT-PCR e mRNA-seq genome-wide, respectivamente. Os dados qualitativos e quantitativos obtidos a partir destes ensaios de fornecer novos insights sobre o comportamento social dos tumores clonais. Além disso, eles produzem uma base sólida para estudos funcionais sobre o papel dos genes individuais, redes genéticas e microambiente do tumor em diferentes fases e aspectos da tumorigénese.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

Para demonstrar o potencial da técnica eyFLP-marcm para gerar manchas marcadas com GFP de genótipos definidos em Drosophila EAD, foram induzidos três tipos de clones: (1) controle somente expressando GFP, (2) tumores malignos expressar uma forma oncogénica do pequeno Ras (Ras V12) da proteína G em um fundo de perda homozigótica de um scribble gene supressor de tumor (Scrib 1), e (3) sobrecrescimento mas não invasivo ras V12...

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Este protocolo demonstra como gerar tumores clonais fluorescente marcada, geneticamente definidas no Drosophila olho / discos imaginais antenares (DAE). Ele descreve como dissecar o EAD e do cérebro a partir do terceiro larvas e como processá-los para visualizar e quantificar as mudanças de expressão gênica e invasão tumoral.

o<em&gt; Drosophila</em&gt; Imaginal Modelo Disc Tumor: visualização e quantificação da expressão gênica e invasão tumoral Usando Mosaicos Genéticos

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

Um modelo de tumor de murino de bexiga ortotópico e Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Pesquisa do câncer

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Indução e diagnóstico de tumores em<em&gt; Drosophila</em&gt; Epitelio do disco imaginal

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

Knockdown condicional de expressão gênica em linhas de células de câncer para estudar o recrutamento de monócitos/macrófagos para o microambiente do Tumor

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

O estabelecimento de um ensaio de colonização de pulmão para visualização de células de Tumor nos tecidos do pulmão de circulação

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Radionuclídeo-fluorescência Gene do repórter de imagem para controlar a progressão do Tumor em modelos de roedores Tumor

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

Modelo de pulmão acelular e celular para estudar o Tumor metástase

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

Ensaio de reação em cadeia de polimerase digital para a variação genética em paciente esporádicos polipose adenomatosa familiar usando o formato de microplaqueta-em-um-tubo

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Investigação de dependências genéticas utilizando ensaios de competição baseados em CRISPR-Cas9

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

A aplicação clínica do Tumor, tratamento de terapia de campos em Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...