Name: the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics
Uploaded: 2016-10-06T14:00:00
Description: Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Br&#252;ckner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.

OBS: Detta arbete utnyttjar eyFLP1; handling&gt; y +&gt; Gal4, UAS-GFP; FRT82B, tub-GAL80 MARCM 82B Grön testare linje 11. Passerar MARCM 82B gröna tester jungfrur till hannar av stammar såsom vikt; UAS-a; UAS-b RNAi, FRT82B c mut genotyp kommer att ge avkomma där mitotiska rekombination sker mellan rätt armar 3 rd homologa kromosomer. På detta sätt, kommer kloner homozygot mutant för gen c beläget distalt om FRT82B site genereras inom EAD och hjärna...

<ol>
	<li>Miles, W. O., Dyson, N. J., Walker, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+tumor+invasion+and+metastasis+in+Drosophila.">Modeling tumor invasion and metastasis in Drosophila.</a> Dis Model Mech. 4 (6), 753-761 (2011).</li><li>Stefanatos, R. K. A., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+invasion+and+metastasis+in+Drosophila:+a+bold+past,+a+bright+future.">Tumor invasion and metastasis in Drosophila: a bold past, a bright future.</a> J Genet Genomics. 38 (10), 431-438 (2011).</li><li>Patel, P. H., Edgar, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+design:+How+Drosophila+tumors+remodel+their+neighborhood.">Tissue design: How Drosophila tumors remodel their neighborhood.</a> Semin Cell Dev Biol. 28, 86-95 (2014).</li><li>Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+melanogaster:+a+model+and+a+tool+to+investigate+malignancy+and+identify+new+therapeutics.">Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics.</a> Nat Rev Cancer. 13 (3), 172-183 (2013).</li><li>Lee, T., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+for+Drosophila+neural+development.">Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development.</a> Trends Neurosci. 24 (5), 251-254 (2001).</li><li>Xu, T., Rubin, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+genetic+mosaics+in+developing+and+adult+Drosophila+tissues.">Analysis of genetic mosaics in developing and adult Drosophila tissues.</a> Development. 117 (4), 1223-1237 (1993).</li><li>Struhl, G., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organizing+activity+of+wingless+protein+in+Drosophila.">Organizing activity of wingless protein in Drosophila.</a> Cell. 72 (4), 527-540 (1993).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118 (2), 401-415 (1993).</li><li>Wu, J. S., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+mosaic+analysis+with+a+repressible+cell+marker+(MARCM)+in+Drosophila.">A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila.</a> Nat Protoc. 1 (6), 2583-2589 (2006).</li><li>Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=scribble+mutants+cooperate+with+oncogenic+Ras+or+Notch+to+cause+neoplastic+overgrowth+in+Drosophila.">scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila.</a> EMBO J. 22 (21), 5769-5779 (2003).</li><li>Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+Drosophila+for+metastatic+behavior.">A genetic screen in Drosophila for metastatic behavior.</a> Science (New York, NY). 302 (5648), 1227-1231 (2003).</li><li>Uhlirova, M., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JNK-+and+Fos-regulated+Mmp1+expression+cooperates+with+Ras+to+induce+invasive+tumors+in+Drosophila.">JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila.</a> EMBO J. 25 (22), 5294-5304 (2006).</li><li>Turkel, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BTB-zinc+finger+transcription+factor+abrupt+acts+as+an+epithelial+oncogene+in+Drosophila+melanogaster+through+maintaining+a+progenitor-like+cell+state.">The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.</a> PLoS Genet. 9 (7), e1003627 (2013).</li><li>Cordero, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Ras+Diverts+a+Host+TNF+Tumor+Suppressor+Activity+into+Tumor+Promoter.">Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter.</a> Dev Cell. 18 (6), 999-1011 (2010).</li><li>Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Drosophila,+RhoGEF2+cooperates+with+activated+Ras+in+tumorigenesis+through+a+pathway+involving+Rho1-Rok-Myosin-II+and+JNK+signalling.">In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling.</a> Dis Model Mech. 6, 661-678 (2013).</li><li>Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sds22/PP1+links+epithelial+integrity+and+tumor+suppression+via+regulation+of+myosin+II+and+JNK+signaling.">Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling.</a> Oncogene. 30 (29), 3248-3260 (2011).</li><li>Figueroa-Clarevega, A., Bilder, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malignant+Drosophila+Tumors+Interrupt+Insulin+Signaling+to+Induce+Cachexia-like+Wasting.">Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting.</a> Dev Cell. 33 (1), 47-55 (2015).</li><li>Newsome, T. P., Asling, B., Dickson, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Drosophila+photoreceptor+axon+guidance+in+eye-specific+mosaics.">Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics.</a> Development. 127 (4), 851-860 (2000).</li><li>Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homology+of+the+eyeless+gene+of+Drosophila+to+the+Small+eye+gene+in+mice+and+Aniridia+in+humans.">Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans.</a> Science. 265 (5173), 785-789 (1994).</li><li>K&#252;lshammer, E., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+actin+cross-linker+Filamin/Cheerio+mediates+tumor+malignancy+downstream+of+JNK+signaling.">The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling.</a> J Cell Sci. 126 (Pt 4), 927-938 (2013).</li><li>North, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Seeing+is+believing?+A+beginners'+guide+to+practical+pitfalls+in+image+acquisition.">Seeing is believing? A beginners' guide to practical pitfalls in image acquisition.</a> J Cell Biol. 172 (1), 9-18 (2006).</li><li>Waters, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accuracy+and+precision+in+quantitative+fluorescence+microscopy.">Accuracy and precision in quantitative fluorescence microscopy.</a> J Cell Biol. 185 (7), 1135-1148 (2009).</li><li>Igaki, T., Pagliarini, R. A., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+cell+polarity+drives+tumor+growth+and+invasion+through+JNK+activation+in+Drosophila.">Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila.</a> Curr Biol. 16 (11), 1139-1146 (2006).</li><li>K&#252;lshammer, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interplay+among+Drosophila+transcription+factors+Ets21c,+Fos+and+Ftz-F1+drives+JNK-mediated+tumor+malignancy.">Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy.</a> Dis Model Mech. 8 (10), 1279-1293 (2015).</li><li>Pastor-Pareja, J. C., Wu, M., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+innate+immune+response+of+blood+cells+to+tumors+and+tissue+damage+in+Drosophila.">An innate immune response of blood cells to tumors and tissue damage in Drosophila.</a> Dis Model Mech. 1 (2-3), 144-154 (2008).</li><li>Chatterjee, N., Bohmann, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+&#934;C31+based+reporter+system+for+measuring+AP-1+and+Nrf2+signaling+in+Drosophila+and+in+tissue+culture.">A versatile &#934;C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture.</a> PloS One. 7 (4), e34063 (2012).</li><li>Petraki, S., Alexander, B., Br&#252;ckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assaying+Blood+Cell+Populations+of+the+Drosophila+melanogaster+Larva.">Assaying Blood Cell Populations of the Drosophila melanogaster Larva.</a> J Vis Exp. (105), (2015).</li><li>Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peripheral+nervous+system+supports+blood+cell+homing+and+survival+in+the+Drosophila+larva.">The peripheral nervous system supports blood cell homing and survival in the Drosophila larva.</a> Development. 138 (24), 5379-5391 (2011).</li><li>Kurucz, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemese,+a+hemocyte-specific+transmembrane+protein,+affects+the+cellular+immune+response+in+Drosophila.">Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila.</a> Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).</li><li>Andersen, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+TNF+receptor+Grindelwald+couples+loss+of+cell+polarity+and+neoplastic+growth.">The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth.</a> Nature. 522 (7557), 482-486 (2015).</li><li>Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+remodeling+is+essential+for+Drosophila+disc+eversion+and+tumor+invasion.">Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion.</a> Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).</li><li>Larionov, A., Krause, A., Miller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+standard+curve+based+method+for+relative+real+time+PCR+data+processing.">A standard curve based method for relative real time PCR data processing.</a> BMC Bioinformatics. 6 (1), (2005).</li><li>Blair, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+techniques+for+studying+Drosophila+development.">Genetic mosaic techniques for studying Drosophila development.</a> Development. 130 (21), 5065-5072 (2003).</li><li>Mirth, C. K., Shingleton, A. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrating+body+and+organ+size+in+Drosophila:+recent+advances+and+outstanding+problems.">Integrating body and organ size in Drosophila: recent advances and outstanding problems.</a> Front Endocrinol. 3 (49), (2012).</li><li>French, V., Feast, M., Partridge, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Body+size+and+cell+size+in+Drosophila:+the+developmental+response+to+temperature.">Body size and cell size in Drosophila: the developmental response to temperature.</a> J Insect Physiol. 44 (11), 1081-1089 (1998).</li><li>Ashburner, M., Bonner, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+induction+of+gene+activity+in+drosophila+by+heat+shock.">The induction of gene activity in drosophila by heat shock.</a> Cell. 17 (2), 241-254 (1979).</li><li>Frazier, M. R., Woods, H. A., Harrison, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactive+effects+of+rearing+temperature+and+oxygen+on+the+development+of+Drosophila+melanogaster.">Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster.</a> Physiol Biochem Zool. 74 (5), 641-650 (2001).</li><li>Lai, S. L., Lee, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+mosaic+with+dual+binary+transcriptional+systems+in+Drosophila.">Genetic mosaic with dual binary transcriptional systems in Drosophila.</a> Nat Neurosci. 9 (5), 703-709 (2006).</li><li>Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Q+system:+a+repressible+binary+system+for+transgene+expression,+lineage+tracing,+and+mosaic+analysis.">The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis.</a> Cell. 141 (3), 536-548 (2010).</li><li>del Valle Rodr&#236;guez, A., Didiano, D., Desplan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Power+tools+for+gene+expression+and+clonal+analysis+in+Drosophila.">Power tools for gene expression and clonal analysis in Drosophila.</a> Nature Methods. 9 (1), 47-55 (2011).</li><li>Rynes, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activating+Transcription+Factor+3+Regulates+Immune+and+Metabolic+Homeostasis.">Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis.</a> Mol Cell Biol. 32 (19), 3949-3962 (2012).</li><li>Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+role+of+the+steroid-deficiency+protein+ecdysoneless+in+pre-mRNA+splicing.">Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing.</a> PLoS Genet. 10 (4), e1004287 (2014).</li><li>Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+Specific+Cell+Population+by+Fluorescence+Activated+Cell+Sorting+(FACS).">Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS).</a> J Vis Exp. (41), (2010).</li><li>Tauc, H. M., Tasdogan, A., Pandur, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolating+intestinal+stem+cells+from+adult+Drosophila+midguts+by+FACS+to+study+stem+cell+behavior+during+aging.">Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging.</a> J Vis Exp. (94), (2014).</li></ol>

Teknikerna för att generera genetiska mosaiker i Drosophila är bland de mest sofistikerade verktyg för att analysera och manipulera geners funktion 33. Den eyFLP-MARCM systemet har visat stark och robust eftersom den tillåter induktion av visuellt markerade genetiskt definierade kloner i ett rumsligt begränsat sätt, det vill säga i vävnader där eyeless förstärkare är aktiv 9,18. Detta är särskilt viktigt när flera genetiska skador kombineras i samma celler....

Cancer är en av de mest genetiskt heterogen grupp av sjukdomar, vars förekomst och dödligheten ökar dramatiskt, särskilt bland de äldre över hela världen. Cancer härstammar klonalt från en tumör initiera cell som flyr inneboende tumörsuppressor mekanismer och delar utom kontroll. Den gradvisa ackumuleringen av genetiska skador som kooperativt främjar tillväxt, spridning och rörlighet samtidigt hämma död och differentiering omvandlar den initiala godartad överväxt till en mycket malign, metastatisk och dödlig tumör. Det har blivit uppenbart att förutom genetiska förändringar kräver tumörprogression förändringar i den omgivande stroma och överhörning mellan tumörtyper och flera cell (t.ex. fibroblaster, immun och endotelceller) i sin mikromiljö. Att förstå de molekylära principerna malign transformation inklusive tumör stroma interaktioner är av stor betydelse för att utveckla förebyg-tions och tidig screening strategier, samt nya och effektiva behandlingar för att bekämpa cancer metastaser och läkemedelsresistens. Bananflugan Drosophila melanogaster har blivit ett attraktivt system för cancerforskning 1-4 på grund av dess snabba generationstid, anmärkningsvärt bevarande av signalnoder mellan flugor och människor, begränsad genetisk redundans och rikedom av avancerade genetiska verktyg som underlättar manipulation av nästan varje gen i tillfälligt och spatialt begränsat sätt. Genetiskt definierade tumörer med varierande malignitet kan reproducerbart konstruerad i Drosophila genom att införa GAIN- och förlust av funktionsmutationer i en delmängd av stamceller i en annars vildtyp vävnad med hjälp av MARCM teknik 5. Den MARCM verktyget kombinerar FLP / FRT (FLP rekombinas / FLP Recognition Target) -medierad mitotisk rekombination sex med FLP-out 7 och Gal4 / UAS (Upstream Activation Sequence) 8 målgenenexpressionssystem 9. Med denna metod uttryck för någon UAS-baserade transgen, inklusive onkogen eller fluorescerande protein cDNA eller inverterade DNA upprepningar för dsRNA-inducerad geners uttryck, kommer att begränsas till en klon av celler som har förlorat en specifik genetisk lokus och en Gal4 repressor på grund av rekombination (Figur 1A). Klonala fläckar märkta med grönt fluorescerande (GFP) eller röd fluorescerande proteiner (t.ex., RFP, DsRed, mCherry) kan lätt spåras genom hela utvecklingen, isoleras och analyseras. Viktigt, kan deras beteende direkt jämföras med den intilliggande vild vävnadstyp. Således, frågor som är relevanta för cellen autonoma och icke-självständiga effekter av genetiska skador kan enkelt studeras. I likhet med däggdjur, endast kloner där flera onkogena lesioner kombineras bli elakartade i Drosophila och rekapitulera viktiga kännetecken för däggdjur cancer. De overproliferate, undvika apoptos, framkalla inflammation, blir odödlig och invafattande slutligen dödar värden 10-17. Här beskriver vi ett protokoll för att generera genetiskt definierade klonala tumörer i ögat / antenn och hjärnvävnad av Drosophila larver med hjälp av MARCM teknik. Metoden förlitar sig på en MARCM testare lager som uttrycker jäst FLP rekombinas under kontroll av den eyeless förstärkare (eyFLP) 18,19. På detta sätt, är GFP-märkta kloner genereras i både peripodial och kolumnär epitel av EAD och neuroepitelet av hjärnan under hela embryo- och larvstadier (fig 1A, B och referens 20). Kloner kan lätt följas förrän i vuxen ålder som EAD utvecklas till vuxna öga, antenn och huvudet kapsel medan neuroepithelium ger upphov till neuroblaster som producerar differentierade optiska lob nervceller. För att underlätta omfattande molekylära, funktionella och fenotypiska karaktärisering av mosaik vävnad, vi deskrivare ett protokoll för dissektion av EAD och hjärnan från tredje stadiet larver och beskriva hur man behandlar dem för tre olika applikationer: (i) detektering av transgena fluorescerande reportrar och immunfärgning, (ii) kvantifiering av tumörinvasion och (iii) analys av genuttryck ändras med hjälp av en kvantitativ realtids-PCR (QRT-PCR) eller en hög genomströmning mRNA sekvensering (mRNA-punkter) (Figur 1C). Immunfärgning protokoll kan användas för att visualisera vilket som helst protein av intresse med en specifik antikropp. Transgena fluorescerande transkriptions reportrar ger bekväm och exakt Spatiotemporal information om aktiviteten hos en viss signalväg. Cell-härstamning specifika reportrar, å andra sidan, speglar kvalitativa och kvantitativa förändringar i cellpopulationer inom mosaik vävnad och bland tumörer i olika genotyper. Kvantifiering av invasiv beteende underlättar jämförelse av tumör malignitet mellan genotyps. Slutligen är det protokoll som beskriver insamling och behandling av mosaik EAD för RNA-isolering lämpar sig för både små och storskaliga tillämpningar nedströms såsom omvänd transkription följt av QRT-PCR och genomet hela mRNA-punkter, respektive. De kvalitativa och kvantitativa data från dessa analyser ger nya insikter i sociala beteende klonala tumörer. Dessutom, de producerar en solid grund för funktionella studier om vilken roll enskilda gener, genetiska nätverk och tumörmikro i olika stadier och aspekter av tumörbildning.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Agar</td>
			<td style="width:177px;">Gew&#252;rzm&#252;hle Brecht, Eggenstein, Germany</td>
			<td style="width:151px;">00262-0500</td>
			<td style="width:476px;">Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85&#176;C.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Corn syrup</td>
			<td style="width:177px;">Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany</td>
			<td style="width:151px;">01939</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Propionic acid</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6026.1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cornmeal</td>
			<td style="width:177px;">ReformKontor GmbH, Zarrentin, Germany</td>
			<td style="width:151px;">4010155063948</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Malt extract</td>
			<td style="width:177px;">CSM Deutschland GmbH, Bremen, Germany</td>
			<td style="width:151px;">728985</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Soy flour</td>
			<td style="width:177px;">Stockmeier Food GmbH, Herford, Germany</td>
			<td style="width:151px;">1000246441010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Yeast</td>
			<td style="width:177px;">Werner Ramspeck GmbH, Schwabach, Germany</td>
			<td style="width:151px;">210099K</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Methyl-4-benzoate/ Nipagin</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">H5501</td>
			<td style="width:476px;">Prepare a 15% stock solution with 70% EtOH</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food vials</td>
			<td style="width:177px;">Kisker Biotech, Steinfurt, Germany</td>
			<td style="width:151px;">789008</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vial plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Drosophila fly food bottles</td>
			<td style="width:177px;">Greiner Bio-One, Frickenhausen, Germany</td>
			<td style="width:151px;">960177</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bottle plugs</td>
			<td style="width:177px;">K-TK e.K., Retzstadt, Germany</td>
			<td style="width:151px;">1002 S</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">81381</td>
			<td style="width:476px;">Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50&#176;C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20&#176;C.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">1,4-Diazabicyclo[2.2.2]octane/ DABCO&#160;</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D2522</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">9002-93-1</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate-buffered saline/ PBS</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBST</td>
			<td style="width:177px;"></td>
			<td style="width:151px;"></td>
			<td style="width:476px;">0.1% Triton X-100 in PBS</td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde/ PFA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">158127</td>
			<td style="width:476px;">4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 &#176;C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 &#181;l Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20&#176;C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes)</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bovine Serum Albumin/ BSA</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">A3059</td>
			<td style="width:476px;">Blocking solution recipe: Dissolve 0.3% BSA in PBST</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">4&#8217;,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI</td>
			<td style="width:177px;">Carl Roth GmbH, Karlsruhe, Germany</td>
			<td style="width:151px;">6335</td>
			<td style="width:476px;">DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4&#176;C. Used in dilution 1:1000 in PBST.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Alexa Flour 546 Phalloidin</td>
			<td style="width:177px;">Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">A22283</td>
			<td style="width:476px;">Used in dilution 1:500 in PBST.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Mouse anti-H2 antibody</td>
			<td style="width:177px;">Kurucz et al., 2003</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L)</td>
			<td style="width:177px;">Jackson ImmunoResearch, Suffolk, UK</td>
			<td style="width:151px;">715-175-151</td>
			<td style="width:476px;">Used in dilution 1:500 in blocking solution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dumont #5 forceps</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">11295-10</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Glass embryo dish (30 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">E90</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tungsten needles</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">10130-20</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nickel Plated Pin Holder</td>
			<td style="width:177px;">Fine Science Tools, Heidelberg, Germany</td>
			<td style="width:151px;">26018-17</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Microscope slides</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 22 x 22 mm (#1 Menzel-Gl&#228;ser)</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">631-1336</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Coverslips 24 x 50 mm (0.13-0.16 mm)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">1076371</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kimtech Science Precision Wipes</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">06-677-70</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dissecting stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX7 (DF PLAPO 1X-4 Japan)</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Fluorescent stereomicroscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera</td>
			<td style="width:476px;">Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Confocal microscope</td>
			<td style="width:177px;">Olympus, Hamburg, Germany</td>
			<td style="width:151px;">FV1000</td>
			<td style="width:476px;">Equipped with inverted IX81 microscope. Objectives: 20&#215; UPlan S-Apo (NA 0.85), 40&#215; UPlanFL (NA 1.30) and 60&#215; UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Drosophila cooled incubator</td>
			<td style="width:177px;">Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany</td>
			<td style="width:151px;">&#160;Sanyo MIR553</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Squirt bottle</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">215-8105</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">BD Clay Adams Nutator Mixer</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">15172-203</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ELMI Digital Rocking Shaker</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">DRS-12</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 PRIME Isol-RNA Lysis Reagent</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">2302700</td>
			<td style="width:476px;">The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596).</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Diethyl pyrocarbonate/ DEPC</td>
			<td style="width:177px;">Sigma-Aldrich, Deisenhofen, Germany</td>
			<td style="width:151px;">D5758</td>
			<td style="width:476px;">Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1)</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td style="width:151px;">15593-031</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Chloroform</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">102445</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">TURBO DNase (2 U/&#181;l)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">AM2238</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Invitrogen UltraPure Glycogen</td>
			<td style="width:177px;">ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany</td>
			<td>10-814-010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Sodium acetate trihydrate</td>
			<td style="width:177px;">VWR, Darmstadt, Germany</td>
			<td style="width:151px;">27652.232</td>
			<td style="width:476px;">Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">2-Propanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">109634</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethanol</td>
			<td style="width:177px;">Merck, Darmstadt, Germany</td>
			<td style="width:151px;">100983</td>
			<td style="width:476px;">Prepare a 75% EtOH dilution with DEPC-H2O.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UV/Vis-Spectrophotometre NanoDrop ND-8000</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">ND-8000</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Eppendorf Microcentrifuge (Refrigerated)</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">5417R</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion RNA StdSens Analysis Kit</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007103</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Experion Automated Electrophoresis Station</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">7007010</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SuperScript III Reverse Transcriptase</td>
			<td style="width:177px;">Thermo Scientific, Schwerte, Germany</td>
			<td style="width:151px;">18080044</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Oligo d(T) Primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td style="width:476px;">Prepare 100 &#181;M stock solutions in DEPC-H20 and store at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">dNTP Mixture</td>
			<td style="width:177px;">Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France</td>
			<td style="width:151px;">4030</td>
			<td style="width:476px;">Store aliquots of 25 &#181;l at -20&#176;C</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFX96 Touch Real-Time PCR Detection System</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">1855195</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">iQ SYBR Green Supermix</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">170-8882</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Hard-Shell PCR Plates 96-well, thin wall</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">HSP9601</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Microseal &#39;B&#39; Film</td>
			<td style="width:177px;">Bio-Rad Laboratories GmbH, M&#252;nchen, Germany</td>
			<td style="width:151px;">MSB1001</td>
			<td style="width:476px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; TCCTACCAGCTTCAAGATGAC 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">rp49 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; CACGTTGTGCACCAGGAACT 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Forward primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; AGGGCGACAAGTACTACAAGCTGA 3&#39;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">mmp1 Reverse primer</td>
			<td style="width:177px;">Integrated DNA Technologies, Leuven, Belgium</td>
			<td style="width:151px;"></td>
			<td>5&#39; ACGTCTTGCCGTTCTTGTAGGTGA 3&#39;</td>
		</tr>
	</tbody>
</table>

the drosophila imaginal disc tumor model: visualization and quantification of gene expression and tumor invasiveness using genetic mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

För att visa potentialen för eyFLP-MARCM teknik för att generera GFP-märkt fläckar av definierade genotyper i Drosophila EAD, var tre typer av kloner inducerade: (1) kontroll uttrycker GFP enbart (2) maligna tumörer som uttrycker en onkogen form av små G-protein Ras (Ras V12) i en bakgrund av homozygot förlust av en tumörsuppressorgen klotter (Scrib 1), och (3) igenväxning men icke-invasiv ras-V12 Scrib en</su...

Watch this Scientific Journal Video about The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics at JoVE.com

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Detta protokoll visar hur man skapar fluorescerande märkt, genetiskt definierade klonala tumörer i Drosophila ögat / antenn imaginal skivor (EAD). Den beskriver hur man dissekera EAD och hjärnan från tredje stadiet larver och hur man behandlar dem att visualisera och kvantifiera genuttryck förändringar och tumörinvasion.

De<em&gt; Drosophila</em&gt; Imaginal skiva Tumör Modell: Visualisering och kvantifiering av genuttryck och tumör invasiv använda genetiska mosaiker

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

Research

JoVE Journal

Cancer Research

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

En Murin Orthotopic blåstumör modell och Tumör Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induction and Diagnosis of Tumors in Drosophila Imaginal Disc Epithelia

Induktion och diagnos av tumörer i<em&gt; Drosophila</em&gt; Imaginal Disc Epithelia

In the early stages of cancer, transformed mutant cells show cytological abnormalities, begin uncontrolled overgrowth, and progressively disrupt tissue ...

Conditional Knockdown of Gene Expression in Cancer Cell Lines to Study the Recruitment of Monocytes/Macrophages to the Tumor Microenvironment

Villkorliga Nedslagning av genuttryck i Cancer cellinjer att studera rekrytering av monocyter/makrofager att den tumör mikromiljö

siRNA and shRNA-mediated knock down (KD) methods of regulating gene expression are invaluable tools for understanding gene and protein function. However, ...

The Establishment of a Lung Colonization Assay for Circulating Tumor Cell Visualization in Lung Tissues

Inrättandet av en Lung Colonization analys för cirkulerande tumör Cell visualisering i lungvävnad

Metastasis is the major cause of cancer death. The role of circulating tumor cells (CTCs) in promoting cancer metastasis, in which lung colonization by ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Radionuklid-fluorescens Reporter gen Imaging för att spåra tumör Progression i gnagare tumör modeller

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Acellular and Cellular Lung Model to Study Tumor Metastasis

Acellulärt och cellulära Lung modell att studera tumör metastasering

It is difficult to isolate tumor cells at different points of tumor progression. We created an ex vivo lung model that can show the interaction of tumor ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

Digitala polymeras Chain Reaction Assay för den genetiska variationen i en sporadisk familjär adenomatös polypos Patient med formatet Chip-i-ett-rör

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Utredning av genetiska beroenden med CRISPR-Cas9-baserade konkurrens analyser

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

The Clinical Application of Tumor Treating Fields Therapy in Glioblastoma

Klinisk tillämpning av tumör behandling av fält terapi i Glioblastoma

Glioblastoma is the most common and lethal form of brain cancer, with a median survival of 15 months after diagnosis and a 5 year survival rate of only 5% ...