Name: inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks
Uploaded: 2016-12-24T13:00:00
Duration: 11 min 4 s
Description: Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

This work was supported by a National Science Foundation Grant NSF-MCB1243645 (JZT), any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the National Science Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

NOTE: Une vue d&#39; ensemble de la génération de lignées cellulaires stables inductibles LAP marqués pour toute protéine d&#39;intérêt est illustrée à la figure 1 et la vue d&#39; ensemble de l&#39; expression de la protéine LAP-tagged, la purification et la préparation de protéomique de masse analyses est illustrée à la figure 3. 1. Clonage du cadre de lecture ouvert (ORF) du gène d&#39;intérêt dans le LAP-tag Vector <ol><li> Clonage de l&#39;ORF du gène d&#39;intérêt dans la navette Vector. <ol><li> Utiliser la réaction en chaîne par polymérase (PCR) pour amplifier l&#39;ORF d&#39;intérêt avec les attB1 et attB2 des sites appropriés dans les amorces pour l&#39;une ou l&#39;autre fusion N-terminale ou une fusion C-terminale. Voir le tableau 1 pour les séquences d&#39;amorces et le tableau 2 pour les conditions de PCR. </li><li> Gel purifie les produits PCR par leur résolution sur un gel d&#39;agarose à 1%. Exciser la bande amplifiée qui est la taille correcte du gel et l&#39;extraire de la tranche de gel en utilisant un ADN gkit d&#39;extraction el selon les instructions du fabricant. </li><li> Incuber le attB purifié contenant des produits de PCR avec un attP contenant le vecteur navette et la recombinase qui permet aux produits de PCR se recombiner dans le vecteur selon les instructions du fabricant (voir M atières Table). NOTE: Les vecteurs navettes vides et LAP-marquage vecteurs contiennent le gène ccd B et doivent être propagé dans des cellules bactériennes résistantes ccd B (voir tableau des matériaux). Toutefois , le gène ccdB est recombinée quand un ORF est inséré dans ces vecteurs, donc utiliser des cellules standard DH5a de E. coli lors de la propagation des vecteurs avec des ORFs clonées. </li><li> Transformer des cellules DH5a de E. coli avec 1 pl du produit de la réaction et de la plaque les cellules transformées sur un bouillon de Luria (LB) gélose avec 50 mg / ml de kanamycine 13. </li><li> Sélectionnez les colonies résistantes à la kanamycine. </li><li> Cultivez les colonies sélectionnées dans LB-moide diamètre avec 50 mg / ml de kanamycine, faire une mini-préparation d&#39;ADN et confirmer l&#39; intégration du gène par un séquençage d&#39;ADN en utilisant les amorces de séquençage énumérées dans le tableau 3. </li></ol></li><li> Transfert du gène d&#39;intérêt de la navette du vecteur dans le LAP-tag Vector. <ol><li> Incuber le vecteur navette contenant le gène de la séquence vérifiée d&#39;intérêt ORF avec le vecteur LAP-tag (pGLAP1 pour la fusion N-terminal) et la recombinase qui médie le transfert du gène d&#39;intérêt du vecteur navette dans le vecteur LAP-tag selon les instructions du fabricant (voir Matériaux). NOTE: Une série de vecteurs LAP / TAP qui peuvent être utilisés en fonction du promoteur désiré, épitope-étiquette, et N ou le marquage C-terminal peuvent être trouvés dans le tableau 4. </li><li> Transformer des cellules DH5a de E. coli avec 1 pl du produit de la réaction et de la plaque les cellules transformées sur une plaque d&#39;agar LB contenant 100 mg / ml 13 d&#39; ampicilline. </li><li> Sélectionnez la colo résistant à l&#39;ampicillineNEI. </li><li> Cultivez les colonies sélectionnées dans un milieu LB avec 100 mg / ml ampicilline, faire une mini-préparation d&#39; ADN, et de confirmer l&#39; intégration du gène par séquençage d&#39;ADN en utilisant les amorces de séquençage énumérées dans le tableau 5. </li></ol></li></ol> 2. Génération d&#39;un inductible cellulaire Stable ligne qui exprime le gène LAP-étiqueté d&#39;intérêt <ol><li> Sélectionnez la ligne qui convient le mieux pour le projet d&#39;intérêt de la cellule. En variante, créer une lignée de cellules d&#39;hôte à partir d&#39;une quelconque lignée cellulaire existant qui exprime de manière constitutive le TetR et contient un site FRT qui permet au gène LAP marqués d&#39;intérêt devant être intégré de manière stable dans le génome (voir Matériaux). Remarque: Ce protocole utilise une lignée de cellules HEK293 qui contient le TetR et un site FRT, qui est cultivé dans -tet DMEM / F12 [faite avec 10% de sérum de fœtus bovin (FBS) qui est dépourvu de tetracycline (-tet)] 4 . </li><li> Déterminer la concentration minimale de hygromycine nécessaire pour tuer la lignée cellulaire hôte en 1 à 2 weeks après addition de la drogue. La concentration peut varier entre les lignées de cellules hôtes, la majorité se situant entre 100 pg / ml et 800 pg / ml. NOTE: les cellules HEK293 cultivées dans -tet DMEM / F12 avec 100 pg / ml d&#39; hygromycine à 37 ° C et 5% de CO 2 va mourir dans les 1-2 semaines. </li><li> Co-transfecter le vecteur qui exprime la recombinase flippase (médie l&#39;intégration du gène LAP étiquetée d&#39;intérêt dans le site FRT dans le génome de la cellule) avec le vecteur LAP étiqueté dans des cellules HEK293 en utilisant un réactif de transfection selon les instructions du fabricant . Utiliser un ratio de 4: 1 du vecteur de recombinase à vecteur LAP 14. NOTE: Le rapport optimal dépend de la lignée cellulaire hôte et le procédé de transfection, et peut nécessiter un titrage. Un rapport de 4: 1 fonctionne bien pour la plupart des lignées cellulaires. Inclure une plaque maquette transfectées comme témoin négatif. </li><li> Un jour après la transfection, remplacer le support / F12 -tet DMEM avec des milieux frais. </li><li> Deux jours après transfectile fractionnement de cellules, à 25% de confluence. Laisser les cellules ~ 5 h à attacher, puis ajouter hygromycine contenant -tet DMEM / F12 à la concentration prédéterminée dans l&#39;étape 2.2. Pour HEK293 cellules utilisent 100 pg / ml d&#39;hygromycine. REMARQUE: Le TRAF contenant une lignée cellulaire HEK293 contient également le TetR qui est associée à la résistance à la blasticidine, par conséquent, 5 ug / ml de blasticidine est utilisé pendant le processus de sélection de lignées cellulaires stables pour choisir le TetR et pour minimiser l&#39;expression qui fuit. </li><li> Remplacer hygromycine contenant -tet DMEM / F12 selon les besoins jusqu&#39;à ce que des foyers de cellules distinctes apparaissent qui ressemblent à des taches opaques contre la plaque transparente. </li><li> Ajouter 20 pi de trypsine au-dessus de chacun des foyers de cellules et de haut en bas pipeter 2 fois avec une pointe de pipette de 200 pi. La place des cellules dans une plaque 24 puits et étendre les cellules par une croissance continue dans hygromycine contenant -tet DMEM / F12. </li><li> cellules d&#39;écran pour inductible expression de la protéine LAP marqués par cellule fixe ou des cellules vivantes de microscopie par fluorescence et / ouWestern blot pour la balise GFP dans le LAP-tag 15. </li></ol> 3. Purification des complexes de protéines LAP-tagged NOTE: Les LAP-tagged purification de protéines détails protocolaires recommandations suivantes sur les conditions et les volumes utilisés pour une protéine purification typique LAP-tagged basé sur l&#39;expérience précédente. Cependant, il faut être prudent pour veiller à ce que l&#39;optimisation empirique est effectuée pour tout niveau d&#39;intérêt expression complexe de protéines et de protéines pour fournir les meilleurs résultats. <ol><li> La croissance cellulaire et la cellule de récolte. <ol><li> Développez la lignée cellulaire LAP-tagged validé pour l&#39; isolement du TAP de complexes protéiques, par passage en permanence toutes les cellules HEK293 dans des plaques plus grandes et / ou des bouteilles à rouleaux dans -tet DMEM / F12 à 37 ° C et 5% de CO 2. </li><li> Pour les souris Tet / Dox lignées cellulaires inductibles, pour induire de 10 à 15 heures à une concentration de 0,2 pg / ml Tet / Dox lorsque les cellules ont atteint ~ 70% de confluence avant harvesting de cellules. NOTE: Le temps de concentration et de l&#39;induction doit être déterminé pour chaque protéine, un titrage de 0,1-1 pg / ml Tet / Dox pendant 10-15 heures est recommandé. </li><li> Récolte des cellules par agitation ou trypsinisation et pellets cellules à 875 g pendant 5-10 min. </li></ol></li><li> Accouplement anti-GFP anticorps à des billes de protéine A <ol><li> Utilisez 40 ug d&#39;anticorps pour l&#39;immunoprécipitation d&#39;un lysat préparé à partir d&#39;une pastille de 0,5 ml de cellules, hématocrite (PCV). NOTE: La quantité d&#39;anticorps nécessaire dépendra de l&#39;abondance de la protéine LAP-marqué, entre autres facteurs, et nécessitera l&#39;optimisation. Un titrage de 10 à 40 pg est recommandée. </li><li> Equilibrer 160 ul de volume compressé (PV) des billes de protéine A dans du PBST (PBS + 0,1% de Tween-20) dans un tube de 1,5 ml. Laver 3 fois avec 1 ml de PBST. NOTE: Tous les lavages des présentes sont réalisées par centrifugation des perles à 5000 xg pendant 10 sec. </li><li> Remettre les billes dans 500 pi PBST et ajouter 80 pg d&#39;affinitélapin anti-GFP purifié à anticorps à chaque tube de 160 perles ul. Mélanger pendant 1 heure à la température ambiante (RT). </li><li> Laver les billes 2 fois avec 1 ml de PBST. Ensuite, les perles de lavage 2 fois avec 1 ml de 0,2 M de borate de sodium, pH 9 (20 ml 0,2 M borate de sodium + 15 ml de 0,2 M d&#39;acide borique). Après le lavage final, ajouter 900 pi de borate de sodium 0,2 M, pH 9 pour amener le volume final à 1 ml. </li><li> Ajouter 100 ul de 220 mM dimethylpimelimidate (DMP) à une concentration finale de 20 mM. Tournez doucement les tubes à température ambiante pendant 30 min. Pour mM DMP 220, resuspendre contenu d&#39;un flacon de 50 mg dans 877 ul de 0,2 M borate de sodium, pH 9 et ajouter immédiatement à la suspension de billes. </li><li> Après incubation avec le DMP, laver les perles 1 fois avec 1 ml de 0,2 M d&#39;éthanolamine, 0,2 M de NaCl, pH 8,5 pour inactiver l&#39;agent de reticulation résiduel. Resuspendre les billes dans 1 ml du même tampon et tournent pendant 1 heure à température ambiante. perles de granules et de perles de remettre en suspension dans 500 ul de 0,2 M éthanolamine, 0,2 M de NaCl pH 8,5. Perles sont stables pour several mois à 4 ° C. </li></ol></li><li> Préparation de tampons pour Lyse des cellules et purification du complexe <ol><li> Préparation des tampons LAPX (où X est la concentration en sel désirée [KCI mM] du tampon LAP; 300 mM pour la lyse des cellules, 200 mM pour la plupart des lavages de talon, et 100 mM pour les billes de lavage des protéines avant l&#39;élution) en faisant un 7,4 solution à pH contenant mM d&#39; acide 4- (2-hydroxyéthyl) -1-50 piperazineethanesulfonic (HEPES), X mM de KCl, 1 mM d&#39; acide éthylèneglycol tétraacétique (EGTA) 1 mM de MgCl2 et 10% de glycérol. REMARQUE: Les composants de ce tampon sont utilisés pour rapprocher l&#39;environnement dans les cellules vivantes. HEPES est utilisé comme un tampon dans la rage de pH de 7,2-8,2. KCI est un sel utilisé pour maintenir la force ionique du tampon. EGTA est un agent chélatant qui lie les ions calcium pour réduire les niveaux de calcium par rapport au magnésium. Le glycérol et MgCl2 sont utilisés pour améliorer la stabilité des protéines. </li><li> Préparer tampon LAPX N en ajoutant 0,05% nonyle phenoxypolyethoxylethanol au tampon de LAPX. REMARQUE: nonyl phenoxypolyethoxylethanol est un détergent qui solubilise les protéines, mais préserve les interactions protéine-protéine, ainsi une concentration plus élevée est utilisée pendant le processus d&#39;extraction et il est ensuite abaissée au cours des étapes de liaison et de lavage. </li></ol></li><li> Préparation des lysats cellulaires <ol><li> Remettre en suspension 500 pi de CVP dans 2,5 ml de LAP300 avec du dithiothréitol 0,5 mM (DTT) et les inhibiteurs de protéase. Ajouter 90 ul de 10% nonyle phenoxypolyethoxylethanol (0,3% final) et mélanger par retournement. </li><li> Placer sur la glace pendant 10 min. Centrifugeuse à 21.000 xg pendant 10 min. Recueillir ce surnageant à faible vitesse (LSS). Prélever un échantillon de 10 ul du LSS pour l&#39;analyse sur gel. </li><li> Transfert LSS à un tube de TLA100.3 et de spin à 100.000 xg pendant 1 h à 4 ° C. Recueillir ce surnageant à grande vitesse (HSS), dans un tube et le placer sur la glace. Prélever un échantillon de 10 pi de la SSC pour l&#39;analyse sur gel. REMARQUE: Évitez de prendre le plus haut sommet lipidique couche d&#39;und de la couche inférieure la plus débris cellulaires. La couche lipidique doit être éliminé par aspiration sous vide avant de recueillir le HSS. </li></ol></li><li> Première capture d&#39;affinité: Reliure à Perles Anti-GFP <ol><li> Pré-éluées des billes d&#39;anticorps couplés (utilisent 160 ul de perles par 0,5 ml de culot cellulaire (PCV)) en les lavant 3 fois avec 1 ml de tampon d&#39; élution [3,5 M de MgCl2 à 20 mM de Tris, pH 7,4] pour se débarrasser de découplée anticorps et réduisent fond. Faites vite. Ne laissez pas des perles en sel élevée pendant une longue période. </li><li> Laver les billes 3 fois avec 1 ml de N LAP200. Mélanger HSS extrait avec des billes d&#39;anticorps pendant 1 heure à 4 ° C. Centrifugeuse à 21.000 xg pendant 10 min. Prélever un échantillon de 10 ul du surnageant ( par exemple, le débit (FT)) pour une analyse sur gel. </li><li> Lavez perles 3 fois avec 1 ml de LAP200 N avec des inhibiteurs de 0,5 mM de DTT et de la protéase. Lavez perles 2 fois (5 min chacun) avec 1 ml de LAP200 N avec des inhibiteurs de 0,5 mM de DTT et de la protéase. Laver rapidement 2 times avec 1 ml de N LAP200 avec 0,5 mM de DTT et sans inhibiteurs de protéase avant d&#39; ajouter la protéase du virus etch du tabac (TEV). </li></ol></li><li> TEV Décolleté <ol><li> Diluer 10 ug protéase TEV dans 1 ml de N LAP200 et faire tourner les tubes à 4 ° C pendant une nuit. REMARQUE: Cette étape peut être optimisée pour toute protéine LAP-étiqueté à être complété en quelques heures en ajustant la concentration de la protéase TEV, qui peut aider à la préservation des complexes de protéines LAP-tagged. </li><li> perles à granulés et le transfert surnageant à un nouveau tube. Rincer perles deux fois avec 160 ul LAP200 N avec 0,5 mM de DTT et les inhibiteurs de la protéase (concentration triple) pour éliminer toute protéine résiduelle. Prélever un échantillon de 10 ul du surnageant pour l&#39;analyse sur gel. </li></ol></li><li> Deuxième Capture d&#39;affinité: Reliure à S Protein Agarose <ol><li> Laver 1 tube de 80 ul de protéine S agarose suspension (40 pi de résine emballé) 3 fois avec 1 ml de N LAP200. REMARQUE: S protliaison ein à l&#39;étiquette S va reconstituer une RNase active et une deuxième étiquette d&#39;épitope alternatif doit être pris en considération pour l&#39;ARN contenant des complexes protéiques. </li><li> Ajouter TEV élue surnageant à S billes de protéine d&#39;agarose et de roche pendant 3 heures à 4 ° C. Perles de granules et laver 3 fois avec 1 ml de LAP200 N avec des inhibiteurs de 0,5 mM de DTT et de la protéase. Laver les billes 2 fois avec 1 ml de LAP100. </li></ol></li><li> On élue la protéine <ol><li> Éluer des protéines de la protéine S d&#39;agarose en ajoutant 50 pi de Laemmli 4x tampon d&#39;échantillon et on chauffe à 97 ° C pendant 10 min. REMARQUE: Les protéines peuvent être éluées à partir des billes avec du tampon d&#39;élution (3,5 M de MgCl2 à 20 mM de Tris, pH 7,4). </li></ol></li></ol> 4. Identifier les protéines interagissant par analyse de spectrométrie de masse <ol><li> Tester la qualité de la purification par l&#39;analyse des échantillons prélevés par électrophorèse sur gel de polyacrylamide en présence de dodécylsulfate de sodium (SDS-PAGE), coloration à l&#39;argent du gel (voir <strong&gt; Matériaux de table) et par immunotransfert éluats et le sondage avec des anticorps anti-GFP pour faire en sorte que la purification LAP-tagged travaillé 16, voir la figure 4. </li><li> Pour identifier les espèces co-purifiantes stoechiométriques et stoechiométriques, prélever l&#39;échantillon final d&#39;élution et le séparer par SDS-PAGE. Colorer le gel avec une spectrométrie de masse de protéines compatible tache. Exciser les groupes les plus importants et l&#39;espace entre eux à partir du gel et de les traiter pour l&#39; analyse par spectrométrie de masse séparément 16. NOTE: Il existe de nombreuses approches pour séparer les éluats finales de purification et de les préparer à la spectrométrie de masse 5. Par exemple, les complexes LAP purifiés peuvent être élues à partir de perles S-protéine en utilisant haute teneur en sel (3,5 M MgCl 2) et l&#39; ensemble de la population de protéines en masse peut être analysé par spectrométrie de masse 17. Alternativement, éluats finaux peuvent être séparés pour 1 mm par SDS-PAGE et une seule bande de 1 mm peut être excised et analysés. Cela efface le mélange complexe de toutes les billes ou les matières particulaires qui interfèrent avec l&#39;analyse. </li></ol>

     

<ol>
	<li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration.">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat Biotechnol. 17, 1030-1032 (1999).</li><li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tandem+affinity+purification+(TAP)+method:+a+general+procedure+of+protein+complex+purification.">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li><li>Cheeseman, I. M., Desai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+combined+approach+for+the+localization+and+tandem+affinity+purification+of+protein+complexes+from+metazoans.">A combined approach for the localization and tandem affinity purification of protein complexes from metazoans.</a> Sci STKE. , (2005).</li><li>Torres, J. Z., Miller, J. J., Jackson, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+generation+of+tagged+stable+cell+lines+for+proteomic+analysis.">High-throughput generation of tagged stable cell lines for proteomic analysis.</a> Proteomics. 9, 2888-2891 (2009).</li><li>LaCava, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Affinity+proteomics+to+study+endogenous+protein+complexes:+pointers,+pitfalls,+preferences+and+perspectives.">Affinity proteomics to study endogenous protein complexes: pointers, pitfalls, preferences and perspectives.</a> Biotechniques. 58, 103-119 (2015).</li><li>Landy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic,+structural,+and+regulatory+aspects+of+lambda+site-specific+recombination.">Dynamic, structural, and regulatory aspects of lambda site-specific recombination.</a> Annu Rev Biochem. 58, 913-949 (1989).</li><li>Hartley, J. L., Temple, G. F., Brasch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+cloning+using+in+vitro+site-specific+recombination.">DNA cloning using in vitro site-specific recombination.</a> Genome Res. 10, 1788-1795 (2000).</li><li>ORFeome Collaboration. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ORFeome+Collaboration:+a+genome-scale+human+ORF-clone+resource.">The ORFeome Collaboration: a genome-scale human ORF-clone resource.</a> Nat Methods. 13, 191-192 (2016).</li><li>Brasch, M. A., Hartley, J. L., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ORFeome+cloning+and+systems+biology:+standardized+mass+production+of+the+parts+from+the+parts-list.">ORFeome cloning and systems biology: standardized mass production of the parts from the parts-list.</a> Genome Res. 14, 2001-2009 (2004).</li><li>Lamesch, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hORFeome+v3.1:+a+resource+of+human+open+reading+frames+representing+over+10,000+human+genes.">hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.</a> Genomics. 89, 307-315 (2007).</li><li>Rual, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ORFeome+version+1.1:+a+platform+for+reverse+proteomics.">Human ORFeome version 1.1: a platform for reverse proteomics.</a> Genome Res. 14, 2128-2135 (2004).</li><li>Fiering, S., Kim, C. G., Epner, E. M., Groudine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+&amp;#34;in-out&amp;#34;+strategy+using+gene+targeting+and+FLP+recombinase+for+the+functional+dissection+of+complex+DNA+regulatory+elements:+analysis+of+the+beta-globin+locus+control+region.">An &amp;#34;in-out&amp;#34; strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.</a> Proc Natl Acad Sci U S A. 90, 8469-8473 (1993).</li><li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (1989).</li><li>Uyttersprot, N., Costagliola, S., Miot, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+tool+for+efficient+transfection+of+dog+and+human+thyrocytes+in+primary+culture.">A new tool for efficient transfection of dog and human thyrocytes in primary culture.</a> Mol Cell Endocrinol. 142, 35-39 (1998).</li><li>Senese, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+insertion+in+STARD9's+motor+domain+regulates+its+stability.">A unique insertion in STARD9's motor domain regulates its stability.</a> Mol Biol Cell. 26, 440-452 (2015).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+X-Linked-Intellectual-Disability-Associated+Ubiquitin+Ligase+Mid2+Interacts+with+Astrin+and+Regulates+Astrin+Levels+to+Promote+Cell+Division.">The X-Linked-Intellectual-Disability-Associated Ubiquitin Ligase Mid2 Interacts with Astrin and Regulates Astrin Levels to Promote Cell Division.</a> Cell Rep. 14, 180-188 (2016).</li><li>Graumann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applicability+of+tandem+affinity+purification+MudPIT+to+pathway+proteomics+in+yeast.">Applicability of tandem affinity purification MudPIT to pathway proteomics in yeast.</a> Mol Cell Proteomics. 3, 226-237 (2004).</li><li>Connolly, J. A., Kalnins, V. I., Cleveland, D. W., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunoflourescent+staining+of+cytoplasmic+and+spindle+microtubules+in+mouse+fibroblasts+with+antibody+to+tau+protein.">Immunoflourescent staining of cytoplasmic and spindle microtubules in mouse fibroblasts with antibody to tau protein.</a> Proc Natl Acad Sci U S A. 74, 2437-2440 (1977).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tctex1d2+associates+with+short-rib+polydactyly+syndrome+proteins+and+is+required+for+ciliogenesis.">Tctex1d2 associates with short-rib polydactyly syndrome proteins and is required for ciliogenesis.</a> Cell Cycle. 14, 1116-1125 (2015).</li><li>Cheung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+Analysis+of+the+Mammalian+Katanin+Family+of+Microtubule-severing+Enzymes+Defines+Katanin+p80+subunit+B-like+1+(KATNBL1)+as+a+Regulator+of+Mammalian+Katanin+Microtubule-severing.">Proteomic Analysis of the Mammalian Katanin Family of Microtubule-severing Enzymes Defines Katanin p80 subunit B-like 1 (KATNBL1) as a Regulator of Mammalian Katanin Microtubule-severing.</a> Mol Cell Proteomics. 15, 1658-1669 (2016).</li><li>Torres, J. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+STARD9/Kif16a+Kinesin+Associates+with+Mitotic+Microtubules+and+Regulates+Spindle+Pole+Assembly.">The STARD9/Kif16a Kinesin Associates with Mitotic Microtubules and Regulates Spindle Pole Assembly.</a> Cell. 147, 1309-1323 (2011).</li><li>Garcia-Gonzalo, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transition+zone+complex+regulates+mammalian+ciliogenesis+and+ciliary+membrane+composition.">A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition.</a> Nat Genet. 43, 776-784 (2011).</li><li>Chih, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ciliopathy+complex+at+the+transition+zone+protects+the+cilia+as+a+privileged+membrane+domain.">A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain.</a> Nat Cell Biol. 14, 61-72 (2012).</li><li>Leonetti, M. D., Sekine, S., Kamiyama, D., Weissman, J. S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+scalable+strategy+for+high-throughput+GFP+tagging+of+endogenous+human+proteins.">A scalable strategy for high-throughput GFP tagging of endogenous human proteins.</a> Proc Natl Acad Sci U S A. 113, E3501-E3508 (2016).</li><li>Poser, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BAC+TransgeneOmics:+a+high-throughput+method+for+exploration+of+protein+function+in+mammals.">BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals.</a> Nat Methods. 5, 409-415 (2008).</li><li>Firat-Karalar, E. N., Stearns, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+mammalian+centrosome+structure+using+BioID+proximity-dependent+biotinylation.">Probing mammalian centrosome structure using BioID proximity-dependent biotinylation.</a> Methods Cell Biol. 129, 153-170 (2015).</li><li>Roux, K. J., Kim, D. I., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioID:+a+screen+for+protein-protein+interactions.">BioID: a screen for protein-protein interactions.</a> Curr Protoc Protein Sci. 74, (2013).</li><li>Gupta, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Dynamic+Protein+Interaction+Landscape+of+the+Human+Centrosome-Cilium+Interface.">A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface.</a> Cell. 163, 1484-1499 (2015).</li></ol>

The authors have nothing to disclose.

Le protocole décrit décrit le clonage de gènes d&#39;intérêt dans le vecteur LAP-tagging, la génération de lignées inductibles cellulaires stables LAP-marqués, et la purification des complexes de protéines LAP marqués pour les analyses protéomiques. En ce qui concerne d&#39;autres approches LAP / TAP-tagging, ce protocole a été simplifié pour être compatible avec les approches à haut débit pour cartographier les interactions de localisation des protéines et protéine-protéine dans aucune voie cellulaire. Cette approche a été largement appliquée à la caractérisation fonctionnelle des protéines essentielles pour la progression du cycle cellulaire, l&#39; assemblage du fuseau mitotique, broche pôle homéostasie et ciliogenèse pour ne citer que quelques - uns et a aidé à la compréhension de la façon dont misregulation de ces protéines peut conduire à des maladies humaines 15, 16,19,20. Par exemple, notre groupe a récemment utilisé ce système pour définir la fonction et la régulation de la kinésine STARD9 mitotique (une cible de cancer du candidat) dans l&#39; assemblage de broche 15,21, pour définir unnouveau lien moléculaire entre la chaîne Tctex1d2 dynein de lumière et courts syndromes polydactylie de nervure (SRPS) 19, et de définir une nouvelle liaison moléculaire pour comprendre comment la mutation du ubiquitine ligase Mid2 peut conduire à une déficience intellectuelle liée à l&#39; X 16. D&#39; autres laboratoires ont également appliqué cette méthode avec succès, y compris celui qui a déterminé que Tctn1, un régulateur de souris signalisation Hedgehog, est une partie d&#39;un complexe protéique ciliopathie associé à ce que la composition de la membrane ciliaire régulée et ciliogenèse d&#39;une manière tissu-dépendante 22,23. Par conséquent, ce protocole peut être largement appliqué à la dissection d&#39;une voie cellulaire. Une étape cruciale dans ce protocole est la sélection des lignées cellulaires stables LAP-marqués qui sont résistantes à l&#39;hygromycine. Des précautions particulières doivent être prises pour veiller à ce que toutes les cellules de la plaque de commande sont morts avant de sélectionner des foyers dans la plaque expérimentale pour l&#39;amplification. Hygromycine peut également être Added pendant la culture cellulaire de routine de lignées cellulaires stables LAP-tagged pour assurer en outre que toutes les cellules conservent le gène LAP-marqué d&#39;intérêt sur le site FRT. Nous avertissons que toutes les protéines non LAP marqués seront fonctionnels et qu&#39;il est important d&#39;avoir des essais en place qui peuvent être utilisés pour tester la fonction des protéines. Des exemples de tests utilisés pour tester la fonction des protéines comprennent le sauvetage de phénotypes induits par siRNA et des tests d&#39;activité in vitro. Pour faire face à d&#39;éventuels problèmes avec l&#39;ajout d&#39;un grand LAP-tag, nous avons déjà généré des vecteurs TAP-tag compatibles avec ce système qui contiennent des petites étiquettes, comme FLAG, qui sont moins susceptibles d&#39;inhiber la fonction et la localisation de la protéine d&#39;intérêt 4. En outre, des vecteurs LAP-tagging existent pour générer des protéines LAP-tagged C-terminal ou de protéines TAP marqués C-terminaux qui sont compatibles avec ce système, qui peut être utilisé dans les cas où un / TAP tag LAP est pas tolérée au N -terminale d&#39;une protéine. En outre, econcentrations de sel e et détergentes des tampons de purification (LAPX N) peuvent être modifiés pour augmenter ou diminuer la sévérité de purification si aucun ou trop nombreuses interactions sont observées. De même, le tandem procédure de purification d&#39;affinité est plus rigoureuse que seule des procédures de purification et interacteurs faibles peuvent être perdues, donc un schéma de purification unique peut être utilisée lorsque peu ou pas interacteurs sont identifiés. Il est important de noter que d&#39; autres approches épitope GFP de marquage existent qui permettent la protéine GFP à grande échelle de marquage pour la localisation des protéines et de purification des études 24,25. Ceux - ci comprennent l&#39;approche BAC TransgenOmics qui utilise les chromosomes bactériens artificiels pour exprimer des gènes GFP-tagged d&#39;intérêt à partir de leur environnement natif qui contient tous les éléments de régulation, qui imite l&#39;expression du gène endogène 24. Plus récemment, cas9 / ARN simple guidée (ARN sg) complexes de ribonucléoprotéines (RNP) ont été utilisés pour mettre fin àtag ogenously gènes d&#39;intérêt avec un système split-GFP qui permet l&#39;expression des gènes GFP-marqués de leur locus génomique endogène 25. Bien que ces deux approches permettent l&#39;expression des protéines marquées dans des conditions endogènes, par rapport au protocole LAP-tagging décrit ici, ils ne permettent pas d&#39;expression inductible et accordable des gènes marqués d&#39;intérêt. En outre, ils doivent encore être appliquées à épitope tandem de marquage pour les TAP. Il est également important de noter que d&#39;autres systèmes de marquage peuvent également être modifiés pour devenir compatible avec le système décrit ici pour produire des lignées cellulaires stables inductibles marquage épitopique. Par exemple, l&#39; identification de la biotine proximité dépendant (BioID) a suscité une attention considérable en raison de sa capacité à définir des relations spatiales et temporelles entre les protéines interagissant 26. Cette technique exploite des protéines de fusion à une souche promiscuité de l&#39;Escherichia coli biotine ligase BirA, qui biotinylers toute protéine dans un rayon ~ 10 nm de l&#39;enzyme. Les protéines biotinylées sont ensuite purifiés par affinité en utilisant biotine-capture par affinité et analysée pour la composition par spectrométrie de masse. BirA sera biotinyler une protéine quelconque à proximité, même transitoirement, ce qui le rend particulièrement adapté à la détection de partenaires d&#39; interaction les plus faibles au sein d&#39; un complexe 27. En outre, le schéma de purification ne nécessite pas que les interactions protéine-protéine endogènes restent intacts et peuvent être effectuées dans des conditions de dénaturation, réduisant ainsi le taux de faux positifs. Au sein de notre protocole actuel, la substitution du vecteur pGLAP1 par un vecteur BirA marquage peut transformer ce système à partir de l&#39;identification des interactions protéine-protéine sur la base de l&#39;affinité pour les détecter sur la base de la proximité. Un tel système serait très avantageux pour la détection des interactions protéiques transitoires, comme cela est le cas, entre les multiples interactions enzyme-substrat et pour cartographier l&#39;inté spatiotemporelle protéine-protéineractions au sein des structures définies comme cela a été effectué pour le centrosome et cilia 26,28.

To investigate the cellular function of an uncharacterized protein it is important to determine its in vivo spatiotemporal subcellular localization and its interacting protein partners. Traditionally, single and tandem epitope tags fused to the N or C-terminus of a protein of interest have been used to facilitate protein localization and protein interaction studies. For example, the tandem affinity purification (TAP) technology has enabled the isolation of native protein complexes, even those that are in low abundance, in both yeast and mammalian cell lines1,2. The localization and affinity purification (LAP) technology, is a more recent development that modifies the TAP procedure to include a localization component through the introduction of the green fluorescent protein (GFP) as one of the epitope tags3. This approach has given researchers a deeper understanding of a protein's subcellular localization in living cells while also retaining the ability to perform TAP complex purifications to map protein-protein interaction networks. 
However, there are many issues associated with the use of TAP/LAP technologies that has hampered their widespread use in mammalian cells. For example, the length of time that is necessary to generate a stable cell line expressing a TAP/LAP tagged protein of interest; which typically relies on cloning the gene of interest into a viral vector and selecting single cell stable integrants with the desired expression level. Additionally, many cellular pathways are sensitive to constitutive protein overexpression (even at low levels) and can arrest cells or trigger cell death over time making the generation of a TAP/LAP stable cell line impossible. These and other constraints have impeded LAP/TAP methodologies from becoming high-throughput systems for protein localization and protein complex elucidation. Therefore, there has been considerable interest in the development of an inducible high-throughput LAP-tagging system for mammalian cells that takes advantage of current innovations in cloning and cell line technologies. 
Here we present a protocol for generating stable cell lines with Doxycycline/Tetracycline (Dox/Tet) inducible LAP-tagged proteins of interest that applies advances in both cloning and mammalian cell line technologies. This approach streamlines the acquisition of data with regards to LAP-tagged protein subcellular localization, protein complex purification and identification of interacting proteins4. Although affinity proteomics utilizes a wide range of techniques for protein complex elucidation5, our approach is beneficial for expediting the identification of these complexes and their native interaction networks and is amenable to high-throughput protein tagging that is necessary to investigate complex biological pathways that contain a multitude of protein constituents. Key to this approach are advancements in cloning strategies that enable high fidelity and expedited cloning of target genes into an array of vectors for gene expression in vitro, in various organisms like bacteria and baculovirus, and in mammalian cells6,7. Additionally, the ORFeome collaboration has cloned thousands of sequence validated open reading frames in vectors that incorporate these advances in cloning, which are available to the scientific community8-11. In our system, the pGLAP1 LAP-tagging vector enables the simultaneous cloning of a large number of clones, which facilitates high-throughput LAP-tagging. This expedited cloning procedure is coupled to a streamlined approach for generating cell lines with LAP-tagged genes of interest inserted at a single pre-determined genomic locus. This makes use of cell lines that contain a single flippase recognition target (FRT) site within their genome, which is the site of integration for LAP-tagged genes. These cell lines also express the tetracycline repressor (TetR) that binds to Tet operators (TetO2) upstream of the LAP-tagged genes and silences their expression in the absence of Dox/Tet. This allows for Dox/Tet inducible expression of the LAP-tagged protein at any given time. Having the capability of inducible LAP-tagged protein expression is critical, since many cellular pathways are sensitive to the levels of critical proteins governing the pathway and can arrest cell growth or trigger cell death when these proteins are constitutively overexpressed, even at low levels, making the generation of non-inducible LAP-tagged stable cell lines impossible12.

<table border="0" cellpadding="0" cellspacing="0" width="640">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Flp-In T-REx Core Kit</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">K6500-01</td>
			<td style="width:167px;">Kit for generating cell lines that contain an FRT site and TrtR expression</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-734</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 2.5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-420</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cell stackers</td>
			<td style="width:139px;">Corning CellSTACK</td>
			<td style="width:119px;">3271</td>
			<td>Cell stacker for growing cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">500 mL conical centrifuge tubes</td>
			<td style="width:139px;">Corning&#160;</td>
			<td style="width:119px;">431123</td>
			<td>Tubes for harvesting cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-GFP antibody</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td>Rabbit anti GFP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Affiprep Protein A beads</td>
			<td style="width:139px;">Biorad</td>
			<td style="width:119px;">156-0006</td>
			<td>Used as a matrix for conjugating anti-GFP antibodies</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dimethylpimelimidate (DMP)</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td>21667</td>
			<td>Used for conjugating anti-GFP antibodies to Protein A beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TLA100.3 tubes</td>
			<td style="width:139px;">Beckman</td>
			<td style="width:119px;">349622</td>
			<td>Tubes for centrifuging protein lysates during the clearing step</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TEV protease</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">12575-015</td>
			<td>Used for cleaving the GFP tag off of N-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Precession Protease</td>
			<td style="width:139px;">GE Healthcare</td>
			<td style="width:119px;">27-0843-01</td>
			<td>Used for cleaving the GFP tag off of C-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">S-protein agarose</td>
			<td style="width:139px;">Novagen</td>
			<td style="width:119px;">69704</td>
			<td>Used as a second affinity matrix during the purification of LAP-tagged protein complexes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick DNA gel extraction kit</td>
			<td style="width:139px;">Qiagen</td>
			<td>28704/28706</td>
			<td>For use in purifying PCR products from an agarose gel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BP clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11789020</td>
			<td>Used for cloning ORF PCR products into the pDONR221 shuttle vector</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LR clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11791020</td>
			<td>Used for cloning the ORF of the gene of interest into the pGLAP1 LAP-tagging vector</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">ccdB Survival 2 T1R E. coli</td>
			<td style="width:139px;">Invitrogen</td>
			<td>A10460</td>
			<td>Used for propgating shuttle vectors and pGLAP empty vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fugene 6</td>
			<td style="width:139px;">Promega</td>
			<td>E2691</td>
			<td>Transfection reagent for transfecting vectors into human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">Q100-19</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Doxycycline</td>
			<td style="width:139px;">Clontech</td>
			<td style="width:119px;">631311</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hygromycin B</td>
			<td style="width:139px;">Invitrogen</td>
			<td>10687010</td>
			<td>Drug for selecting stable LAP-tagged integrants</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:139px;">Corning</td>
			<td>61-176-RG</td>
			<td>Drug for selecting Kanamycin resistant bacterial colonies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:139px;">Fisher</td>
			<td>BP1760-5</td>
			<td>Drug for selecting Ampicillin resistant bacterial colonies</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">4-20% Tris Glycine SDS-PAGE gels</td>
			<td style="width:139px;">Biorad</td>
			<td>4561094</td>
			<td>Used for separating protein samples and final LAP-tag purification eluates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Silver Stain Plus Kit</td>
			<td style="width:139px;">Biorad</td>
			<td>1610449</td>
			<td>Used for silver staining the eluates of LAP-tagged pufications and samples collected throughout the purification process&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Coomassie Blue stain</td>
			<td style="width:139px;">Invitrogen</td>
			<td>LC6060</td>
			<td>Used for staining SDS-PAGE gels to visulize LAP-tagged purifications and cutting out protein bands, mass spectrometry compatible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Shuttle vector pDONR221</td>
			<td style="width:139px;">Invitrogen</td>
			<td>12536017</td>
			<td>Shuttle vector for cloning the ORFs of genes of interest</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Flippase expressing vector pOG44</td>
			<td style="width:139px;">Invitrogen</td>
			<td>V600520</td>
			<td>Vector that expresses the Flippase recombinase for integrating LAP-tagged genes into the genome of FRT site containing cell lines</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Platinum Taq DNA Polymerase</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td style="width:119px;">10966018</td>
			<td>Used for PCR amplification of the ORFs of genes of interest</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4X Laemmli sample buffer</td>
			<td style="width:139px;">Biorad</td>
			<td>1610747</td>
			<td>Sample buffer for eluting purified LAP-tagged protein complexes from the bead matrix</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria broth (LB) media</td>
			<td style="width:139px;">Fisher</td>
			<td>BP9723-2</td>
			<td>Used for growing DH5&#945; bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNA miniprep kit</td>
			<td style="width:139px;">Promega</td>
			<td>A1222</td>
			<td>Used for making DNA plasmid minipreps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM/F12 media</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30023.01</td>
			<td>For growing Hek293 human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS lacking Tet</td>
			<td style="width:139px;">Altanta Biologicals</td>
			<td>S10350</td>
			<td>Used for making -Tet DMEM/F12 media for generating and growing inducible LAP-tagged stable cell lines</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30042.01</td>
			<td>For lifting Hek293 cell foci from plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease inhibitor tablets</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11836170001</td>
			<td>Used for making protocol buffers, EDTA-free</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">10% nonyl phenoxypolyethoxylethanol&#160;</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11332473001</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td style="width:139px;">Corning</td>
			<td>21-040-CM</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween-20</td>
			<td style="width:139px;">Fisher</td>
			<td>BP337-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Borate</td>
			<td style="width:139px;">Fisher</td>
			<td>S249-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td style="width:139px;">Fisher</td>
			<td>A78-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanolamine</td>
			<td style="width:139px;">Calbiochem</td>
			<td>34115</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td style="width:139px;">Fisher</td>
			<td>P217-3</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KCl</td>
			<td style="width:139px;">Fisher</td>
			<td>BP358-10</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td style="width:139px;">Fisher</td>
			<td>BP172-25</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgCl2</td>
			<td style="width:139px;">Fisher</td>
			<td>M33-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris base</td>
			<td style="width:139px;">Fisher</td>
			<td>BP152-5</td>
			<td>Used for making protocol buffers</td>
		</tr>
	</tbody>
</table>

inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this principle, the purification of critical proteins required for the functioning of these pathways along with their native interacting partners has not only allowed the mapping of the protein constituents of these pathways, but has also provided a deeper understanding of how these proteins coordinate to regulate these pathways. Within this context, understanding a protein's spatiotemporal localization and its protein-protein interaction network can aid in defining its role within a pathway, as well as how its misregulation may lead to disease pathogenesis. To address this need, several approaches for protein purification such as tandem affinity purification (TAP) and localization and affinity purification (LAP) have been designed and used successfully. Nevertheless, in order to apply these approaches to pathway-scale proteomic analyses, these strategies must be supplemented with modern technological developments in cloning and mammalian stable cell line generation. Here, we describe a method for generating LAP-tagged human inducible stable cell lines for investigating protein subcellular localization and protein-protein interaction networks. This approach has been successfully applied to the dissection of multiple cellular pathways including cell division and is compatible with high-throughput proteomic analyses.

Pour mettre en évidence l&#39;utilité de ce système, le cadre de lecture ouvert (ORF) de la protéine de liaison de tau aux microtubules a été clone dans le vecteur navette en amplifiant le Tau ORF avec des amorces contenant attB1 et attB2 emplacements (tableau 1) et l&#39; incubation des produits de PCR avec le vecteur navette et une recombinase qui médie l&#39;introduction des produits de PCR dans le vecteur navette. Les produits de réaction ont été utilisés pour transformer des bactéries DH5a 13 et l&#39; ADN de plasmide à partir des colonies résistantes à la kanamycine a été séquencée pour assurer une insertion Tau. Une séquence validée navette Tau vecteur a été ensuite utilisé pour transférer le Tau ORF dans le vecteur pGLAP1, qui fusionne Tau dans le cadre avec le LAP (EGFP-TEV-S-Protein) tag, en incubant le vecteur navette Tau avec le vecteur pGLAP1 et la recombinase qui médie le transfert de l&#39;ORF à partir du vecteur navette pour pGLAP1. Les produits de réaction ont été utilisés pour transformer des bactéries DH5a13 l&#39; ADN et le plasmide à partir des colonies résistantes à l&#39; ampicilline a été séquence pour s&#39;assurer que la fusion LAP-Tau est dans le cadre. Séquence validé pGLAP1-LAP-Tau a ensuite été co-transfectées avec un vecteur qui exprime l&#39;enzyme flippase de recombinaison dans des cellules HEK293 qui contenait une cible de reconnaissance de flippase unique (FRT) du site dans leur génome, qui est le site de l&#39;intégration des gènes LAP-tagged 14. Cette lignée cellulaire a également exprimé l&#39;TetR qui se lie aux opérateurs Tet en amont des gènes LAP-marqués et fait taire leur expression en l&#39;absence de Tet / Dox. intégrants stables ont été sélectionnées avec -tet du milieu DMEM / F12 avec 100 pg / ml d&#39;hygromycine pendant 5 jours. Hygromycine foyers de cellules résistantes individuelles ont été récoltées en ajoutant 20 pi de trypsine sur le dessus et pipetant 2 fois. Les cellules ont été placées dans une plaque de 24 puits et développées par la croissance continue des -tet DMEM / F12. Pour vérifier que la cellule résistant à l&#39;hygromycines étaient capables d&#39;exprimer LAP-Tau, des cellules HEK293 LAP-Tau ont été induites avec 0,1 pg / ml de Dox pendant 15 heures et des extraits protéiques ont été préparés à partir de cellules non induites et induites par Dox. Ces extraits ont été séparés par SDS-PAGE, transférés sur une membrane de PVDF, et immunotransférés pour la GFP et la tubuline en tant que témoin de chargement. Comme on le voit sur la figure 4A, LAP-Tau (visualisée à l&#39; aide des anticorps anti-GFP) a été exprimé seulement en présence de Dox. Pour valider LAP-Tau est correctement localisée à la broche de microtubules mitotique lors de la mitose, comme cela a été montré précédemment pour Tau endogène 18, HEK293 LAP-Tau ont été induites avec 0,1 pg / ml de Dox pendant 15 heures et les cellules ont été fixées avec 4% paraformaldéhyde et co-colorées pour l&#39;ADN (Hoechst 33342) et microtubules (anticorps anti-tubuline). Systématiquement, LAP-Tau a été localisé sur le fuseau mitotique lors de la métaphase de la mitose (figure 4B). Pour vérifier que le LAP-Tau et ses protéines interagissant pourrait être purifiée avec ce system, des cellules HEK293 LAP-Tau ont été cultivées dans des flacons roulants à ~ 70% de confluence, induites avec 0,1 pg / ml de Dox pendant 15 heures, récoltées par agitation, lysées avec un tampon LAP300 et LAP-Tau a été purifié en utilisant le protocole ci-dessus. Éluats de la purification LAP-Tau ont été résolus par SDS-PAGE et le gel a été coloré à l&#39;argent. Figure 4C montre la purification LAP-Tau, marqué d&#39;un astérisque est LAP-Tau et plusieurs autres bandes indicatives de protéines interagissant Tau peut être vu. <img alt="Figure 1" src="/files/ftp_upload/54870/54870fig1.jpg" /> Figure 1: Vue d&#39; ensemble de la génération de inductibles lignées cellulaires stables LAP marqués pour toute protéine d&#39;intérêt. Le cadre de lecture ouvert (ORF) de gènes d&#39;intérêt sont amplifiés avec attB1 et attB2 les sites flanquant 5 &#39;et 3&#39; des séquences terminales, respectivement (les séquences d&#39;amorce sont données en Tableau 1) et clone dans<html> le vecteur navette. La séquence vérifiée des vecteurs navette avec le gène d&#39;intérêt sont ensuite utilisés pour transférer le gène d&#39;intérêt dans le vecteur pGLAP1. La séquence vérifiée pGLAP1 vecteur avec le gène d&#39;intérêt est alors co-transfectées avec le vecteur contenant la recombinase de flippase dans la lignée cellulaire désirée qui contient une cible de reconnaissance de flippase unique (FRT) du site dans leur génome, qui est le site d&#39;intégration pour les LAP gènes -tagged. Ces lignées cellulaires expriment également le répresseur Tet (TetR) qui se lie aux opérateurs de Tet (TetO 2) en amont des gènes LAP marqués et des silences leur expression en l&#39;absence de Tet / Dox. Le gène LAP-marqué d&#39;intérêt est ensuite recombinée dans le site FRT et intégrants stables sont sélectionnés avec hygromycine. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig1large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <html> 2 &quot;src =&quot; / files / ftp_upload / 54870 / 54870fig2.jpg &quot;/&gt; Figure 2: Vue d&#39; ensemble des applications pour stables lignées cellulaires LAP-étiquetés. inductibles lignées cellulaires stables LAP-tagged sont induites pour exprimer la protéine LAP-tagged d&#39;intérêt par addition Dox et peuvent être synchronisés à différents stades du cycle cellulaire ou peuvent être stimulées avec des produits chimiques ou des ligands pour activer toute voie de signalisation souhaitée. La localisation subcellulaire de la protéine LAP étiquetée d&#39;intérêt peut être analysé par imagerie des cellules vivantes ou des cellules fixes. protéines LAP-marqués peuvent également être tandem purifié par affinité et leurs protéines interagissant peut être identifié par chromatographie tandem liquide spectrométrie de masse (LC-MS / MS). Enfin, Cytoscape peut être utilisé pour générer un réseau d&#39;interactions protéine-protéine de la protéine appât. Dox indique Doxycycline, IP immunoprécipité indique, EGFP indique renforcée protéine fluorescente verte, Tev indique la protéase TEV site de clivage, et S indique S-tag.http://ecsource.jove.com/files/ftp_upload/54870/54870fig2large.jpg &quot;target =&quot; _ blank &quot;&gt; S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure. <img alt="Figure 3" src="/files/ftp_upload/54870/54870fig3.jpg" /> Figure 3: Vue d&#39;ensemble des LAP-tagged Protein Expression, purification et préparation pour la spectrométrie de masse. Le protocole a 9 étapes: 1) la croissance et l&#39;induction de l&#39;expression des protéines LAP-tagged, 2) la récolte de cellules et la lyse, 3), la préparation de lysats, 4) la liaison de lysats à des billes anti-GFP, 5) TEV protéase clivage de la GFP-tag, 6) la liaison de lysats à des billes de protéine S, 7) l&#39;élution de la protéine appât et les protéines qui interagissent, et 8-9) la préparation d&#39;échantillons pour les analyses protéomiques basée spectrométrie de masse. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig3large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> </p&gt; <img alt="Figure 4" src="/files/ftp_upload/54870/54870fig4.jpg" /> Figure 4: Vérification de l&#39; expression LAP-Tau. (A) Western Blot (WB) l&#39; analyse des échantillons de protéines à partir de cellules non induites et Dox induite LAP-Tau HEK293 sondées avec des anticorps anti-tubuline l&#39; anti-GFP et pour détecter la protéine Tau LAP-marqués et le contrôle de la tubuline de chargement, respectivement. Notez que LAP-Tau est seulement exprimé lorsque les cellules sont induites avec Dox. Les cellules (B) mitotiques exprimant LAP-Tau ont été fixées et colorées pour la co-ADN (Hoechst 33342) et la tubuline (Tub) avec des anticorps anti-tubuline et la localisation subcellulaire de la protéine tau-LAP ont été analysés par fluorescence microcopie. A noter que LAP-Tau se localise sur la broche et la broche pôles mitotique lors de la mitose. (C) Argent gel coloré de la purification LAP-Tau. MW indique le poids moléculaire, CL indique lysats défrichées et E indicates éluats finales. Les échantillons ont été analysés sur SDS-PAGE à 4-20% et le gel a été coloré à l&#39;argent pour visualiser les protéines purifiées. Notez qu&#39;une bande correspondant au LAP-Tau est marqué d&#39;un astérisque et plusieurs autres bandes correspondant aux protéines co-purification peut être vu. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig4large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> N-terminal fusion </td><td></td></tr><tr><td> Vers l&#39;avant </td><td> 5&#39;GGGGACAAGT TTGTACAAAAAAGCAGGCT TCATG - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> Sens inverse </td><td> 5&#39;GGGGACCACTTTGTACAAGAAAGCTGGGT T TTATCA - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> C-terminal fusion </td><td></td></tr><tr><td> Vers l&#39;avant </td><td> 5&#39;GGGGACAAGTTTGTACAAAAAAGCAGGCT TCACC - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> Sens inverse </td><td> 5&#39;GGGGACCACTTTGTACAAGAAAGCTGGGT G - (&gt; 18gsn) -3 &#39; </td></tr></tbody></table> Tableau 1: avant et arrière Amorces pour Amplifier ORFs ou intérêt pour l&#39; insertion dans la navette du vecteur. Les sites attB sont indiqués en caractères gras, GSN signifie que les nucleotides spécifiques de plus de 18 géniques sont ajoutées à l&#39;amorce. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> Étape </td><td> Température </td><td> Temps </td></tr><tr><td colspan="2"> dénaturation initiale </td><td> 94 ° C, </td><td> 2 minutes </td></tr><tr><td rowspan="3"> Cycles Amplification PCR (35) </td><td> Dénaturer </td><td> 94 ° C, </td><td> 30 sec </td></tr><tr><td> Recuire </td><td> 55 ° C (en fonction de l&#39;amorce Tm) </td><td> 30 sec </td></tr><tr><td> Étendre </td><td> 72 ° C, </td><td> 1 min / kb </td></tr><tr><td colspan="2"> Tenir </td><td> 4 ° C </td><td> indéfiniment </td></tr></tbody></table> Tableau 2: Conditions de PCR pour l&#39; amplification des ORF d&#39;intérêt. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Vecteur </td><td> Sequencing Primer Forward </td><td> Inverser Sequencing Primer </td></tr><tr><td> Vecteur navette </td><td> 5&#39;-TGTAAAACGACGGCCAGT-3 &#39; </td><td> CAGGAAACAGCTATGAC 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 3: directe et inversée Séquençage Amorces pour Shuttle vecteur. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> ID </td><td> Structure </td><td> Parental </td><td> organisateur </td><td> Bac Res </td><td> mam Res </td><td> Tet reg? </td></tr><tr><td> pGLAP1 </td><td> N-term EGFP-TEV-S peptide </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> Amp </td><td> Hyg </td><td> Oui </td></tr><tr><td> pGLAP2 </td><td> N-term Flag-TEV-S peptide </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> Amp </td><td> Hyg </td><td> Oui </td></tr><tr><td> pGLAP3 </td><td> N-term EGFP-TEV-S peptide; C-term V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> Amp </td><td> Hyg </td><td> Non </td></tr><tr><td> pGLAP4 </td><td> N-term Flag-TEV-S peptide; ; C-term V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td&gt; Amp </td><td> Hyg </td><td> Non </td></tr><tr><td> pGLAP5 </td><td> C-term S peptide-PreProt x2-EGFP </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> Amp </td><td> Hyg </td><td> Non </td></tr></tbody></table> Tableau 4: Liste des vecteurs disponibles LAP / TAP avec les promoteurs variables, Epitope-tags, et Dox inductibles capacités d&#39;expression pour N ou protéine de marquage C-terminal. Les vecteurs sont disponibles dans le commerce. Bac Res indique marqueur de résistance bactérienne, mam Res indique mammifère marqueur de résistance cellulaire, Tet reg? indique si l&#39;expression est Tet / Dox régulable. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Vecteur </td><td> Sequencing Primer Forward </td><td> Inverser Sequencing Primer </td></tr><tr><td> pGLAP1 </td><td> 5&#39;-ATCACTCTCGGCATGGACGAGCTGTAGAA-3 &#39; </td><td> TGGCTGGCAACTAGAAGGCACAGTCGAGGC 5&#39;-3 &#39; </td></tr><tr><td> pGLAP2 </td><td> CGAACGCCAGCACATGGACAGGG 5&#39;-3 &#39; </td><td> TGGCTGGCAACTAGAAGGCACAGTCGAGGC 5&#39;-3 &#39; </td></tr><tr><td> pGLAP3 </td><td> AGAAACCGCTGCTGCTAA 5&#39;-3 &#39; </td><td> TAGAAGGCACAGTCGAGG 5&#39;-3 &#39; </td></tr><tr><td> pGLAP4 </td><td> AGACCCAAGCTGGCTAGGTAAGC 5&#39;-3 &#39; </td><td> TAGAAGGCACAGTCGAGG 5&#39;-3 &#39; </td></tr><tr><td> pGLAP5 </td><td> CGTAATACGACTCACTATAG 5&#39;-3 &#39; </td><td> TCCAGGGTCAAGGAAGGCACGG 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 5: directe et inversée Séquençage Apprêts pour pGLAP vecteurs.

Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks.

Inductibles stables lignées cellulaires LAP marqués pour Enquêter la fonction des protéines, Spatiotemporal Localisation et Interaction Networks Protein

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this ...

The overall goal of this procedure is to generate inducible localization and affinity purification, or LAP-tagged stable cell lines, for investigating protein function, spatiotemporal localization, and protein interaction networks. This method can help answer key questions in molecular and cell biology related to protein function, protein cell cycle subzero localization, and protein interactions. The main advantage of this method is that it is amenable to high throughput analysis of groups of proteins, and can be used to dissect the protein components of biological pathways.To begin this procedure, clone the open reading frame of the gene of interest into the LAP-tagged vector and transfect it into HEK293 cells as described in the text protocol. One day post-transfection, replace the minus Tet DMEM/F12 media with fresh media. Two days post-transfection, split the cells to 25%confluence.Allow the cells approximately five hours to attach. Then, add hygromycin-containing minus Tet DMEM/F12 media at the predetermined concentration. For HEK293 cells, use 100 micrograms per milliliter hygromycin.Replace the media as needed until distinct cell foci appear that resemble opaque spots against the transparent plate. Add 20 microliters of trypsin on top of each cell foci and pipe it up and down two times with a 200 microliter pipette tip. Transfer the cells in a 24-well plate and expand the cells by continual growth in hygromycin-containing minus Tet DMEM/F12 media.Expand the validated LAP-tagged cell line for tandem affinity purification, or TAP, isolation of protein complexes. To do so, continually passage all the HEK293 cells into larger plates and/or roller bottles, and minus Tet DMEM/F12 media at 37 degrees Celsius and five percent carbon dioxide. For Tet/Dox inducible cell lines, induce the cells for 10 to 15 hours by adding a concentration of 0.2 micrograms per milliliter Tet/Dox when the cells reach approximately 70%confluency.Harvest the cells by agitation or trypsinization. Then, pellet them at 875 times g for five to 10 minutes. To couple the anti-GFP antibody to protein A beads, equilibrate 160 microliters of packed volume protein A beads with PBST in a 1.5 milliliter tube.Wash the beads three times with 1 milliliter of PBST. Following each wash step throughout this procedure, the beads are centrifuged at 5000 times g for 10 seconds, and the supernatant is removed. After re-suspending the beads in 500 microliters of PBST, add 80 micrograms of affinity purified rapid anti-GFP antibody to each tube, containing 160 microliters of beads.Mix for one hour at room temperature. Wash the beads two times with one milliliter of PBST, then wash the beads two times with one milliliter of 0.2 molar sodium borate, pH After the final wash, add 900 microliters of the sodium borate buffer, to bring the final volume to one milliliter. Then, add 100 microliters of 220 molar DMP to the bead suspension, for a final concentration of 20 millimolar.Rotate the tubes gently at room temperature for 30 minutes. After incubation with DMP, wash the beads one time with one milliliter of 0.2 molar ethanolamine, 0.2 molar sodium chloride pH 8.5, to inactivate the residual crosslinker. Then, re-suspend the beads in one milliliter of the same buffer, and rotate for one hour at room temperature.After pelleting the beads, re-suspend them in an additional 500 microliters of the buffer. The prepared beads are stable for several months at four degrees Celsius. To prepare the cell lysates, re-suspend 500 microliters of packed cell volume into 2.5 milliliters of LAP 300, with 0.5 millimolar DTT and protease inhibitors.Add 90 microliters of 10%nonyl phenoxypolyethoxylethanol, and mix by inversion. Place the mixture on ice for 10 minutes. Centrifuge at 21, 000 times g for 10 minutes.Following centrifugation, collect this low-speed supernatant and set aside a 10 microliter sample for gel analysis. After transferring the low-speed supernatant to a TLA 100.3 tube, spin at 100, 000 times g for one hour at four degrees Celsius. Collect this high-speed supernatant in a tube and place on ice, reserving a 10 microliter sample for gel analysis.For the first affinity capture through binding to anti-GFP beads, pre-elute the antibody-coupled beads by washing them three times with one milliliter of elution buffer to remove the uncoupled antibodies and reduce background. Perform this quickly. Do not leave beads in high salt for a long time.Then, wash the beads three times with one milliliter of LAP 200 N.Next, mix the high-speed supernatant extract with antibody beads for one hour at four degrees Celsius. After centrifuging the extract at 21, 000 times g for 10 minutes, reserve a 10 microliter sample of the supernatant for gel analysis. Perform three quick washes of the beads with one milliliter of LAP 200 N, containing 0.5 millimolar DTT and protease inhibitors.Use the same buffer to wash the beads two additional times with a five minute incubation time for each wash. Then, wash the beads quickly two more times with 1 milliliter of LAP 200 N containing 0.5 millimolar DTT and no protease inhibitors, before adding the Tobacco Etch Virus, or TEV, protease. Add 10 micrograms of the TEV protease in one milliliter of LAP 200 N to the beads, and rotate the tubes at four degrees Celsius overnight.The next day, pellet the beads and transfer the supernatant to a fresh tube. Rinse the beads twice with 160 microliters of LAP 200 N, containing 0.5 millimolar DTT and protease inhibitors to remove any residual protein. For the second affinity capture through binding to S-protein agarose, wash one tube of 80 microliters S-protein agarose slurry three times with one milliliter of LAP 200 N.Add the TEV eluted supernatant to the S-protein beads, and rock them for three hours at four degrees Celsius.After pelleting the beads, wash them three times with one milliliter of LAP 200 N containing 0.5 millimolar DTT and protease inhibitors. Then, wash the beads two times with one milliliter of LAP 100. Elute the proteins off the S-protein agarose by adding 50 microliters of 4x Laemmli sample buffer and heating at 97 degrees Celsius for 10 minutes.To identify interacting proteins by mass spectrometry analysis, test the quality of the purification by analyzing the collected samples by Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis. Silver stain the resulting gel. Also, immunoblot the eluates and probe with anti-GFP antibodies to ensure the LAP-tagged purification worked.To identify stoichiometric and substoichiometric co-purifying species, take the final elution sample and separate it by SDS-PAGE. Stain the gel with a mass spectrometry compatible protein stain. Excise the most prominent bands in the gel and the space in between them to process the bands separately for analysis by mass spectrometry.Shown here is a representative western blot analysis of the protein samples from non-induced and Dox-induced LAP-Tau HEK293 cells. The cells are probed with anti-Tubulin antibodies to detect the Tubulin loading control, and probed with anti-GFP to detect the LAP-tagged Tau protein. Note that LAP-Tau is only expressed when the cells are induced with Dox.Mytotic cells expressing LAP-Tau were fixed and co-stained for DNA and Tubulin with anti-Tubulin antibodies, and the sub-cellular localization of LAP-Tau was analyzed by fluorescence microscopy. Note that LAP-Tau localizes to the mitotic spindle and spindle poles during mitosis. Shown here is a representative silver stained gel of the LAP-Tau purification.The lanes represent the molecular weight, the cleared lysates, and the final eluates. Samples were run on a 4-20%SDS-PAGE gel and the gel was silver stained to visualize the purified proteins. Note that a band corresponding to LAP-Tau is marked with an asterisk, and several other bands corresponding to co-purifying proteins can be seen.After watching this video, you should have a good understanding of how to generate inducible LAP-tagged stable cell lines, and how to perform biochemical purifications of LAP-tagged proteins for proteomic analysis and identification of protein interaction networks.

Research

JoVE Journal

Biology

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

Coloration des protéines dans les gels de Coomassie G-250, sans solvant et l&#39;acide acétique organique

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Recherche

Biologie

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

Utiliser le système de fractionnement GELFREE 8100 pour les Poids Moléculaire à base de fractionnement avec récupération de la phase liquide

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Bimolecular Fluorescence Complementation (BiFC) Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

Bimolecular Fluorescence Complementation BiFC Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

Bimoléculaire complémentation de fluorescence (BiFC) Dosage pour les interactions protéine-protéine dans les cellules d&#39;oignon Utilisation du pistolet à gènes Helios

Investigation of gene function in diverse organisms relies on knowledge of how the gene products interact with each other in their normal cellular ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

Génération de lignées stables de cellules humaines avec inductible par la tétracycline (Tet-on) shRNA ou expression d&#39;ADNc

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Investigating Protein-protein Interactions in Live Cells Using Bioluminescence Resonance Energy Transfer

Étudier les interactions protéine-protéine dans les cellules vivantes en utilisant le transfert d&#39;énergie de résonance de bioluminescence

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live ...

Discovering Protein Interactions and Characterizing Protein Function Using HaloTag Technology

Découvrir interactions des protéines et caractérisation de protéines de fonction utilisant la technologie HaloTag

Research in proteomics has exploded in recent years with advances in mass spectrometry capabilities that have led to the characterization of numerous ...

Identifying Protein-protein Interaction Sites Using Peptide Arrays

Identifier les sites d&#39;interaction protéine-protéine à l&#39;aide de peptides tableaux

Protein-protein interactions mediate most of the processes in the living cell and control homeostasis of the organism. Impaired protein interactions may ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein base Expression dépistage des protéines membranaires dans<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

Selected Reaction Monitoring Mass Spectrometry for Absolute Protein Quantification

Selected Reaction Monitoring spectrométrie de masse pour Absolute quantification des protéines

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Analyse de l’imagerie de la complémentation de luciférase dans les feuilles de Nicotiana benthamiana pour transitoirement déterminant la dynamique Interaction protéine-protéine

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...