Name: inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks
Uploaded: 2016-12-24T13:00:00
Duration: 11 min 4 s
Description: Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

This work was supported by a National Science Foundation Grant NSF-MCB1243645 (JZT), any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the National Science Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

ANMÄRKNING: En översikt av alstring av inducerbara LAP-taggade stabila cellinjer för varje protein av intresse illustreras i figur 1 och en översikt av LAP-märkt protein expression, rening och beredning för mass proteomik analyser illustreras i Figur 3. 1. Kloning den öppna läsramen (ORF) av genen av intresse in i LAP-tag vektor <ol><li> Kloning av ORF av genen av intresse in i skyttelvektorn. <ol><li> Använda polymeraskedjereaktion (PCR) för att amplifiera ORF av intresse med de lämpliga attB1 och attB2 platser inom primrarna för antingen N-terminal fusion eller C-terminal fusion. Se tabell 1 för primersekvenser och tabell 2 för PCR-betingelser. </li><li> Gel rena PCR-produkter genom att lösa dem på en 1% agarosgel. Skära det förstärkta band som är rätt storlek från gelén och extrahera den från gel skiva med hjälp av en DNA-gel utvinning kit enligt tillverkarens anvisningar. </li><li> Inkubera det renade attB innehållande PCR-produkter med en attP innehållande skyttelvektor och rekombinaset som gör att PCR-produkterna för att rekombinera in i vektorn enligt tillverkarens instruktioner (se M aterial tabell). NOT: Tomma skyttelvektorer och LAP-taggningsvektorerna innehåller ccdB-genen och måste förökas i ccd B-resistenta bakterieceller (se Material tabell). Den ccdB genen men rekombineras när en ORF sätts in dessa vektorer, därför använder standard DH5a E. coli-celler när föröknings vektorer med klonade ORF. </li><li> Transformera DH5a E. coli-celler med 1 | j, l av reaktionsprodukten och plattan de transformerade cellerna på en Luria-buljong (LB) agarplatta med 50 mg / ml Kanamycin 13. </li><li> Selektera Kanamycinresistenta kolonier. </li><li> Odla utvalda kolonier i LB migdia med 50 mg / ml Kanamycin, göra en DNA-mini-prep och bekräfta genen integration genom DNA-sekvensering med användning av de sekvenseringsprimrar som anges i tabell 3. </li></ol></li><li> Överföring av genen av intresse från skyttelvektorn i LAP-tag vektor. <ol><li> Inkubera skyttelvektorn innehållande sekvensen verifierades gen av intresse ORF med LAP-tag vektor (pGLAP1 för N-terminal fusion) och rekombinaset som medierar överföring av genen av intresse från skyttelvektorn in i LAP-tag vektor enligt tillverkarens instruktioner (se Material). ANMÄRKNING: En serie av LAP / TAP-vektorer som kan användas baserat på den önskade promotor, epitop-tag, och N eller C-terminala taggning kan hittas i tabell 4. </li><li> Transformera DH5a E. coli-celler med 1 | j, l av reaktionsprodukten och plattan de transformerade cellerna på en LB-agarplatta med 100 mg / ml ampicillin 13. </li><li> Välj ampicillinresistent färbolag. </li><li> Växer de utvalda kolonierna i LB-medium med 100 mg / ml Ampicillin, göra en DNA-mini-prep, och bekräfta gen integration genom DNA-sekvensering med användning av de sekvenseringsprimrar som anges i tabell 5. </li></ol></li></ol> 2. Generering av en inducerbar Stabil cellinje som uttrycker LAP-märkta genen av intresse <ol><li> Välj cellinje bäst lämpad för projektet av intresse. Alternativt skapa en värdcellinje från någon existerande cell-linje som konstitutivt uttrycker TetR och innehåller ett FRT-säte som gör att LAP-märkta genen av intresse som ska integreras stabilt i genomet (se Material). OBS: Detta protokoll använder en HEK293-cellinje som innehåller den TetR och en FRT-säte, som odlas i -Tet DMEM / F12-medium [gjord med 10% fetalt bovint serum (FBS) som saknar Tetracyklin (-Tet)] 4 . </li><li> Bestäm minsta koncentration av Hygromycin krävs för att döda värdcellen linje inom 1-2 weeks efter drogberoende. Koncentrationen kan variera mellan värdcellinjer, med de flesta i intervallet mellan 100 | j, g / ml och 800 pg / ml. OBS: HEK293-celler som odlats i -Tet DMEM / F12-medium med 100 | j, g / ml Hygromycin vid 37 ° C och 5% CO2 kommer att dö inom 1-2 veckor. </li><li> Co-transfektera vektorn som uttrycker flippas rekombinas (medierar integrering av LAP-märkta genen av intresse in i FRT-säte inom genomet hos cellen) med LAP-märkta vektorn i HEK293-celler med användning av ett transfektionsreagens enligt tillverkarens anvisningar . Använda ett förhållande av 4: 1 av rekombinas-vektor för att LAP vektor 14. OBS: Det optimala förhållandet är beroende av värdcellinje och metoden för transfektion, och kan kräva en titrering. Ett förhållande av 4: 1 fungerar bra för de flesta cellinjer. Inkluderar en mock-transfekterad platta som en negativ kontroll. </li><li> En dag efter transfektion, byt ut -Tet DMEM / F12-medium med färskt medium. </li><li> Två dagar efter transfectipå, dela celler till 25% sammanflödet. Låt cellerna ~ 5 h för att fästa, lägg sedan till Hygromycin-innehållande -Tet DMEM / F12-medium vid koncentrationen förutbestämd i steg 2,2. För HEK293 celler använder 100 mikrogram / ml Hygromycin. OBS: FRT innehållande HEK293-cellinje innehåller också TetR som är associerad med Blasticidin motstånd, därför 5 mikrogram / ml Blasticidin används under stabil cellinje urvalsprocess för att selektera för TetR och minimera läckande uttryck. </li><li> Byt Hygromycin-innehållande -Tet DMEM / F12 media som behövs tills distinkta cell fokus verkar som liknar ogenomskinliga fläckar mot den transparenta plattan. </li><li> Tillsätt 20 | il av trypsin på toppen av varje cell foci och pipettera upp och ned 2 gånger med en 200 | j, l pipettspets. Placera celler i en platta med 24 brunnar och expandera cellerna genom kontinuerlig tillväxt i Hygromycin-innehållande -Tet DMEM / F12-medium. </li><li> Skärm celler för inducerbar LAP-märkta proteinuttryck med fast cell eller live-cell fluorescensmikroskopi och / ellerWestern blotting för GFP taggen i LAP-etiketten 15. </li></ol> 3. Rening av LAP-märkt proteinkomplex OBS: Följande LAP-märkt protein reningsprotokoll detaljer rekommendationer om villkor och volymer som används för en typisk LAP-märkta proteinrening baseras på tidigare erfarenheter. Dock bör försiktighet iakttas för att säkerställa att empirisk optimering genomförs för varje proteinkomplex och proteinuttryck intresset för att ge bästa resultat. <ol><li> Celltillväxt och cell Skörd. <ol><li> Expandera den validerade LAP-tagged cellinje för TAP isolering av proteinkomplex, genom att kontinuerligt passage alla HEK293-celler i större plattor och / eller rullflaskor i -Tet DMEM / F12-medium vid 37 ° C och 5% CO2. </li><li> För Tet / Dox inducerbara cellinjer, inducerar efter 10-15 h vid en koncentration av 0,2 | ig / ml Tet / Dox när cellerna når ~ 70% konfluens, innan Harvesting celler. OBS: Tiden och induktion bör bestämmas för varje protein, är en titrering av 0,1-1 | ig / ml Tet / Dox för 10-15 h rekommenderas. </li><li> Harvest celler genom agitation eller trypsinering och pellets celler vid 875 xg under 5-10 min. </li></ol></li><li> Koppling Anti-GFP antikropp till protein A pärlor <ol><li> Använd 40 mikrogram av antikropp för immunprecipitation från ett lysat som framställts från en 0,5 ml cellpellet, packad cellvolym (PCV). OBS: Mängden antikropp som krävs kommer att bero på det överflöd av LAP-märkt protein, bland andra faktorer, och kommer att kräva optimering. En titrering av 10-40 mikrogram rekommenderas. </li><li> Jämvikt 160 il packad volym (PV) Protein A-kulor i PBST (PBS + 0,1% Tween-20) i ett 1,5 ml rör. Tvätta 3 gånger med 1 ml PBST. NOTERA: Alla tvättar häri utförs genom centrifugering av pärlorna vid 5000 x g under 10 sek. </li><li> Resuspendera pärlor i 500 l PBST och tillsätt 80 mikrogram av affinitet-purified kanin-anti-GFP-antikropp till varje rör av 160 | il pärlor. Blanda under 1 h vid rumstemperatur (RT). </li><li> Tvätta pärlor 2 gånger med 1 ml PBST. Då, tvätta pärlor 2 gånger med 1 ml av 0,2 M natriumborat, pH 9 (20 ml 0,2 M natriumborat + 15 ml 0,2 M borsyra). Efter den slutliga tvätten, tillsätt 900 pl av 0,2 M natriumborat, pH 9 för att bringa den slutliga volymen till 1 ml. </li><li> Tillsätt 100 pl av 220 mM dimethylpimelimidate (DMP) till en slutkoncentration av 20 mM. Rotera rören försiktigt vid rumstemperatur under 30 min. För 220 mM DMP, suspendera innehållet i en 50 mg flaska i 877 pl 0,2 M natriumborat, pH 9 och lägger omedelbart till pärlsuspensionen. </li><li> Efter inkubering med DMP, tvätta pärlor en gång med 1 ml 0,2 M etanolamin, 0,2 M NaCl pH 8,5 för att inaktivera det kvarvarande tvärbindningsmedel. Återsuspendera pärlorna i 1 ml av samma buffert och rotera under 1 timme vid RT. Pellets pärlor och återsuspendera pärlor i 500 pl 0,2 M etanolamin, 0,2 M NaCl pH 8,5. Pärlorna är stabila under several månader vid 4 ° C. </li></ol></li><li> Beredning av buffertar för cellys och Complex rening <ol><li> Förbered LAPX buffertar (där X är den önskade saltkoncentrationen [mM KCl] av LAP-buffert, 300 mM för cellys, 200 mm för de flesta pärla tvättar, och 100 mm för att tvätta pärlor före eluering proteiner) genom att göra en pH 7,4 lösning innehållande 50 mM 4- (2-hydroxietyl) -1-piperazinetansulfonsyra (HEPES), X mM KCl, 1 mM etylenglykol tetraättiksyra (EGTA), 1 mM MgCl2 och 10% glycerol. OBS: Komponenterna i denna buffert används för att approximera den miljö i levande celler. HEPES används som en buffert i pH raseri 7,2-8,2. KCl är ett salt som används för att bibehålla jonstyrkan i bufferten. EGTA är en kelatbildare som binder kalciumjoner för att minska halterna av kalcium jämfört med magnesium. Glycerol och MgCl2 användes för att förbättra stabiliteten hos proteiner. </li><li> Förbereda LAPX N-buffert genom att tillsätta 0,05% nonyl phenoxypolyethoxylethanol till LAPX bufferten. OBS: Nonyl phenoxypolyethoxylethanol är en mild detergent som solubiliserar proteiner, men bevarar protein-proteininteraktioner, sålunda en högre koncentration används under extraktionsprocessen och det sänks sedan under de bindande och tvättstegen. </li></ol></li><li> Framställning av cellysat <ol><li> Resuspendera 500 l av PCV i 2,5 ml LAP300 med 0,5 mM ditiotreitol (DTT) och proteashämmare. Lägg 90 pl 10% nonyl phenoxypolyethoxylethanol (0,3% slutlig) och blanda genom inversion. </li><li> Placera på is under 10 min. Centrifugera vid 21.000 xg under 10 minuter. Samla detta låg hastighet supernatanten (LSS). Ta ett prov 10 fil av LSS för gelanalys. </li><li> Överföra LSS till en TLA100.3 rör och centrifugering vid 100.000 xg under 1 h vid 4 ° C. Samla denna höga hastighet supernatanten (HSS), i ett rör och placera på is. Ta ett prov 10 | al av HSS för gelanalys. OBS: Undvik att ta den översta lipidskiktet end botten mest celldebris skiktet. Lipidskiktet bör tas bort genom vakuumsugning före uppsamling av HSS. </li></ol></li><li> Första Affinity Capture: Bindning till Anti-GFP Pärlor <ol><li> Pre-eluerade antikroppskopplade pärlor (använd 160 | il pärlor per 0,5 ml cellpellet (PCV)) genom att tvätta dem 3 gånger med 1 ml elueringsbuffert [3,5 M MgCl2 med 20 mM Tris, pH 7,4] för att bli av med okopplad antikroppar och minska bakgrunden. Gör snabbt. Lämna inte pärlor i hög salthalt under en lång tid. </li><li> Tvätta pärlorna 3 gånger med 1 ml LAP200 N. Blanda HSS extrahera med pärlor antikropp under 1 h vid 4 ° C. Centrifugera vid 21.000 xg under 10 minuter. Ta ett prov 10 | al av supernatanten (dvs., flödet genom (FT)) för gelanalys. </li><li> Tvätta pärlorna 3 gånger med 1 ml LAP200 N med 0,5 mM DTT och proteasinhibitorer. Tvätta pärlor 2 gånger (5 min vardera) med 1 ml LAP200 N med 0,5 mM DTT och proteasinhibitorer. Tvätta snabbt två tIME med 1 ml LAP200 N med 0,5 mM DTT och inga proteasinhibitorer innan du lägger tobaksetsningsvirus (TEV) proteas. </li></ol></li><li> TEV Klyvning <ol><li> Späd 10 | ig TEV-proteas i 1 ml LAP200 N och rotera rören vid 4 ° C över natten. Anmärkning: Detta steg kan optimeras för varje LAP-taggat protein som skall fyllas i på några timmar genom att justera koncentrationen av TEV-proteas, som kan underlätta bevarandet av LAP-märkt proteinkomplex. </li><li> Pellets pärlor och överföra supernatanten till ett nytt rör. Skölja pärlorna två gånger med 160 | il LAP200 N med 0,5 mM DTT och proteasinhibitorer (trippel koncentration) för att avlägsna eventuellt kvarvarande protein. Ta ett prov av supernatanten för gelanalys 10 | il. </li></ol></li><li> Andra Affinity Capture: Bindning till S Protein Agarose <ol><li> Tvätta en tub av 80 | il S-protein-agaros uppslamning (40 pl packade harts) 3 gånger med 1 ml LAP200 N. OBS: S protein bindning till S-taggen rekonstruera en aktiv RNas och en alternativ andra epitopmarkör bör övervägas för RNA innehållande proteinkomplex. </li><li> Lägg TEV eluerade supernatanten till S-protein agaroskulor och rock under 3 h vid 4 ° C. Pellets pärlor och tvätta 3 gånger med 1 ml LAP200 N med 0,5 mM DTT och proteasinhibitorer. Tvätta pärlor 2 gånger med 1 ml LAP100. </li></ol></li><li> protein Eluering <ol><li> Eluera proteiner från S-protein-agaros genom tillsats av 50 | il av 4x Laemmli-provbuffert och värm vid 97 ° C under 10 min. OBS: Proteiner kan också elueras från pärlorna med elueringsbuffert (3,5 M MgCl2 med 20 mM Tris, pH 7,4). </li></ol></li></ol> 4. Identifiera interagerande proteiner med masspektrometri Analys <ol><li> Testa kvaliteten på reningen genom att analysera de insamlade proven genom natriumdodecylsulfat-polyakrylamidgelelektrofores (SDS-PAGE), silverfärgning av gelén (se <strong&gt; Material Table) och genom immunoblotting eluaten och sondering med anti-GFP-antikroppar för att säkerställa att den LAP-taggade rening arbetade 16, se figur 4. </li><li> Att identifiera stökiometriska och understökiometriska co-rening arter, ta det slutliga elueringen provet och separera den genom SDS-PAGE. Färga gelén med en masspektrometri kompatibel protein fläck. Skära de mest framstående band och utrymmet mellan dem från gelén och bearbeta dem för analys med masspektrometri separat 16. OBS: Det finns många metoder för att separera den slutliga reningen eluaten och förbereda dem för masspektrometri 5. Till exempel, kan komplexen LAP renade elueras från S-protein-pärlor genom användning av hög salthalt (3,5 M MgCl2) och hela proteinpopulationen en masse kan analyseras genom masspektrometri 17. Alternativt kan slut eluat separeras för en mm genom SDS-PAGE och en enda 1 mm band kan vara excised och analyseras. Detta raderar den komplexa blandning av några pärlor eller partiklar som kommer att interferera med analysen. </li></ol>

     

<ol>
	<li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration.">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat Biotechnol. 17, 1030-1032 (1999).</li><li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tandem+affinity+purification+(TAP)+method:+a+general+procedure+of+protein+complex+purification.">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li><li>Cheeseman, I. M., Desai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+combined+approach+for+the+localization+and+tandem+affinity+purification+of+protein+complexes+from+metazoans.">A combined approach for the localization and tandem affinity purification of protein complexes from metazoans.</a> Sci STKE. , (2005).</li><li>Torres, J. Z., Miller, J. J., Jackson, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+generation+of+tagged+stable+cell+lines+for+proteomic+analysis.">High-throughput generation of tagged stable cell lines for proteomic analysis.</a> Proteomics. 9, 2888-2891 (2009).</li><li>LaCava, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Affinity+proteomics+to+study+endogenous+protein+complexes:+pointers,+pitfalls,+preferences+and+perspectives.">Affinity proteomics to study endogenous protein complexes: pointers, pitfalls, preferences and perspectives.</a> Biotechniques. 58, 103-119 (2015).</li><li>Landy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic,+structural,+and+regulatory+aspects+of+lambda+site-specific+recombination.">Dynamic, structural, and regulatory aspects of lambda site-specific recombination.</a> Annu Rev Biochem. 58, 913-949 (1989).</li><li>Hartley, J. L., Temple, G. F., Brasch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+cloning+using+in+vitro+site-specific+recombination.">DNA cloning using in vitro site-specific recombination.</a> Genome Res. 10, 1788-1795 (2000).</li><li>ORFeome Collaboration. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ORFeome+Collaboration:+a+genome-scale+human+ORF-clone+resource.">The ORFeome Collaboration: a genome-scale human ORF-clone resource.</a> Nat Methods. 13, 191-192 (2016).</li><li>Brasch, M. A., Hartley, J. L., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ORFeome+cloning+and+systems+biology:+standardized+mass+production+of+the+parts+from+the+parts-list.">ORFeome cloning and systems biology: standardized mass production of the parts from the parts-list.</a> Genome Res. 14, 2001-2009 (2004).</li><li>Lamesch, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hORFeome+v3.1:+a+resource+of+human+open+reading+frames+representing+over+10,000+human+genes.">hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.</a> Genomics. 89, 307-315 (2007).</li><li>Rual, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ORFeome+version+1.1:+a+platform+for+reverse+proteomics.">Human ORFeome version 1.1: a platform for reverse proteomics.</a> Genome Res. 14, 2128-2135 (2004).</li><li>Fiering, S., Kim, C. G., Epner, E. M., Groudine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+&amp;#34;in-out&amp;#34;+strategy+using+gene+targeting+and+FLP+recombinase+for+the+functional+dissection+of+complex+DNA+regulatory+elements:+analysis+of+the+beta-globin+locus+control+region.">An &amp;#34;in-out&amp;#34; strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.</a> Proc Natl Acad Sci U S A. 90, 8469-8473 (1993).</li><li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (1989).</li><li>Uyttersprot, N., Costagliola, S., Miot, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+tool+for+efficient+transfection+of+dog+and+human+thyrocytes+in+primary+culture.">A new tool for efficient transfection of dog and human thyrocytes in primary culture.</a> Mol Cell Endocrinol. 142, 35-39 (1998).</li><li>Senese, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+insertion+in+STARD9's+motor+domain+regulates+its+stability.">A unique insertion in STARD9's motor domain regulates its stability.</a> Mol Biol Cell. 26, 440-452 (2015).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+X-Linked-Intellectual-Disability-Associated+Ubiquitin+Ligase+Mid2+Interacts+with+Astrin+and+Regulates+Astrin+Levels+to+Promote+Cell+Division.">The X-Linked-Intellectual-Disability-Associated Ubiquitin Ligase Mid2 Interacts with Astrin and Regulates Astrin Levels to Promote Cell Division.</a> Cell Rep. 14, 180-188 (2016).</li><li>Graumann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applicability+of+tandem+affinity+purification+MudPIT+to+pathway+proteomics+in+yeast.">Applicability of tandem affinity purification MudPIT to pathway proteomics in yeast.</a> Mol Cell Proteomics. 3, 226-237 (2004).</li><li>Connolly, J. A., Kalnins, V. I., Cleveland, D. W., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunoflourescent+staining+of+cytoplasmic+and+spindle+microtubules+in+mouse+fibroblasts+with+antibody+to+tau+protein.">Immunoflourescent staining of cytoplasmic and spindle microtubules in mouse fibroblasts with antibody to tau protein.</a> Proc Natl Acad Sci U S A. 74, 2437-2440 (1977).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tctex1d2+associates+with+short-rib+polydactyly+syndrome+proteins+and+is+required+for+ciliogenesis.">Tctex1d2 associates with short-rib polydactyly syndrome proteins and is required for ciliogenesis.</a> Cell Cycle. 14, 1116-1125 (2015).</li><li>Cheung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+Analysis+of+the+Mammalian+Katanin+Family+of+Microtubule-severing+Enzymes+Defines+Katanin+p80+subunit+B-like+1+(KATNBL1)+as+a+Regulator+of+Mammalian+Katanin+Microtubule-severing.">Proteomic Analysis of the Mammalian Katanin Family of Microtubule-severing Enzymes Defines Katanin p80 subunit B-like 1 (KATNBL1) as a Regulator of Mammalian Katanin Microtubule-severing.</a> Mol Cell Proteomics. 15, 1658-1669 (2016).</li><li>Torres, J. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+STARD9/Kif16a+Kinesin+Associates+with+Mitotic+Microtubules+and+Regulates+Spindle+Pole+Assembly.">The STARD9/Kif16a Kinesin Associates with Mitotic Microtubules and Regulates Spindle Pole Assembly.</a> Cell. 147, 1309-1323 (2011).</li><li>Garcia-Gonzalo, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transition+zone+complex+regulates+mammalian+ciliogenesis+and+ciliary+membrane+composition.">A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition.</a> Nat Genet. 43, 776-784 (2011).</li><li>Chih, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ciliopathy+complex+at+the+transition+zone+protects+the+cilia+as+a+privileged+membrane+domain.">A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain.</a> Nat Cell Biol. 14, 61-72 (2012).</li><li>Leonetti, M. D., Sekine, S., Kamiyama, D., Weissman, J. S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+scalable+strategy+for+high-throughput+GFP+tagging+of+endogenous+human+proteins.">A scalable strategy for high-throughput GFP tagging of endogenous human proteins.</a> Proc Natl Acad Sci U S A. 113, E3501-E3508 (2016).</li><li>Poser, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BAC+TransgeneOmics:+a+high-throughput+method+for+exploration+of+protein+function+in+mammals.">BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals.</a> Nat Methods. 5, 409-415 (2008).</li><li>Firat-Karalar, E. N., Stearns, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+mammalian+centrosome+structure+using+BioID+proximity-dependent+biotinylation.">Probing mammalian centrosome structure using BioID proximity-dependent biotinylation.</a> Methods Cell Biol. 129, 153-170 (2015).</li><li>Roux, K. J., Kim, D. I., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioID:+a+screen+for+protein-protein+interactions.">BioID: a screen for protein-protein interactions.</a> Curr Protoc Protein Sci. 74, (2013).</li><li>Gupta, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Dynamic+Protein+Interaction+Landscape+of+the+Human+Centrosome-Cilium+Interface.">A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface.</a> Cell. 163, 1484-1499 (2015).</li></ol>

The authors have nothing to disclose.

Den skisserade protokoll beskriver kloningen av gener av intresse in i LAP-tagging vektor, generering av inducerbara LAP-taggade stabila cellinjer, och rening av LAP-märkt proteinkomplex för proteomik analyser. När det gäller andra LAP / TAP-märkning metoder, har detta protokoll effektiviserats för att vara kompatibel med hög genomströmning metoder för att kartlägga proteinlokaliserings och protein-proteininteraktioner inom någon cellulär väg. Detta tillvägagångssätt har i stor utsträckning till den funktionella karakteriseringen av proteiner kritiska för cellcykelprogression, mitotiska spindelenhet, spindel pol homeostas, och ciliogenesis för att nämna några och har hjälpt att förstå hur felaktig reglering av dessa proteiner kan leda till sjukdomar hos människor 15, 16,19,20. Till exempel, vår grupp nyligen utnyttjade detta system för att definiera funktionen och reglering av STARD9 mitotiska kinesin (en kandidat cancer mål) i spindelenheten 15,21, för att definiera ennytt molekylärt samband mellan Tctex1d2 dynein lätta kedjan och korta revben Polydactyly syndrom (SRP: n) 19, och att definiera en ny molekylär länk för att förstå hur mutation av Mid2 ubiquitin ligas kan leda till X-bundna intellektuella funktionsnedsättningar 16. Andra laboratorier har också framgångsrikt tillämpat denna metod, inklusive en som fastställt att Tctn1, en regulator av mus Hedgehog-signalering, var en del av en ciliopathy associerade proteinkomplex som reglerade ciliär membransammansättningen och ciliogenesis i en vävnadsberoende sätt 22,23. Därför kan detta protokoll tillämpas i stort sett dissektion av någon cellulär väg. Ett kritiskt steg i detta protokoll är valet av LAP-märkta stabila cellinjer som är Hygromycin resistenta. Särskild försiktighet bör vidtas för att säkerställa att alla celler i kontrollplattan är död innan du väljer fokus i den experimentella plattan för förstärkning. Hygromycin kan också added under rutin cellodling av LAP-märkta stabil cellinjer att ytterligare säkerställa att alla celler upprätthålla LAP-märkta genen av intresse vid FRT platsen. Vi varnar för att inte alla LAP-märkta proteiner kommer att vara funktionella och att det är viktigt att ha analyser på plats som kan användas för att testa proteiners funktion. Exempel på analyser används för att testa proteiners funktion inkluderar räddningen av siRNA-inducerad fenotyper och in vitro aktivitetsanalyser. För att hantera eventuella potentiella problem med tillsats av en stor LAP-tag, har vi tidigare genererat TAP-tag vektorer som är kompatibla med detta system som innehåller mindre taggar, såsom FLAG, som är mindre benägna att inhibera funktionen och lokaliseringen av proteinet av intresse 4. Dessutom finns det LAP märkning vektorer för generering av C-terminal LAP-märkta proteiner eller C-terminala TAP-taggade proteiner som är kompatibla med detta system, som kan användas i de fall där en LAP / TAP taggen inte tolereras vid N -terminalen av ett protein. Dessutom, the salt och tvättmedel koncentrationer av reningsbuffertar (LAPX N) kan modifieras för att öka eller minska renings stringens om ingen eller alltför många interaktioner observerats. På liknande sätt är strängare än enda reningsprocedurer och svaga Interactmedlemmar kan förloras tandem affinitetsreningsförfarande, således en enda reningsschema kan användas när några eller inga Interactmedlemmar identifieras. Det är viktigt att notera att andra GFP epitop taggning metoder finns som tillåter storskalig GFP protein märkning för protein lokalisering och reningsstudier 24,25. Dessa inkluderar BAC TransgenOmics strategi som utnyttjar bakteriella artificiella kromosomer att uttrycka GFP-märkta gener av intresse från sin ursprungliga miljö som innehåller alla de regulatoriska elementen, som efterliknar endogena genuttryck 24. På senare tid har CAS9 / single-guided RNA (sgRNA) ribonukleoprotein-komplex (RNP) använts för att avslutaogenously märka gener av intresse med en delad GFP system som tillåter uttryck av GFP-märkta gener från sin endogena genomiska loci 25. Även om båda dessa tillvägagångssätt möjliggöra expression av märkta proteiner under endogena förhållanden, jämfört med LAP-märkningsprotokoll som beskrivs här, tillåter de inte för inducerbar och avstämbar expression av de taggade gener av intresse. Dessutom har de ännu inte tillämpas på tandem epitop märkning för TAP. Det är också viktigt att notera att andra taggsystem också kan modifieras för att bli kompatibel med det system som beskrivs här för att generera inducerbara epitopmärkta stabila cellinjer. Till exempel har närhet beroende biotin identifiering (BioID) rönt stor uppmärksamhet på grund av dess förmåga att definiera rumsliga och tidsmässiga relationer mellan interagerande proteiner 26. Denna teknik utnyttjar proteinfusioner till en promiskuös stam av Escherichia coli biotin-ligas BirA som biotinyleras varje protein i en ~ 10 nm radie av enzymet. De biotinylerade proteinerna är därefter affinitetsrenas med användning av biotin-affinitetsinfångning och analyserades beträffande sammansättningen med masspektrometri. BirA kommer biotinylera något protein i omedelbar närhet, till och med övergående, vilket gör den särskilt lämpad för att detektera svagare interagerande partners i en komplex 27. Dessutom gör reningsschemat inte nödvändigt att endogena protein-proteininteraktioner förbli intakt och kan utföras under denatureringsbetingelser, vilket minskar graden av falsklarm. Inom vår nuvarande protokollet, skulle ersättas av pGLAP1 vektorn genom en BirA-märkning vektor omvandla detta system från att identifiera protein-proteininteraktioner baseras på affinitet till att upptäcka dem bygger på närhet. Ett sådant system skulle vara mycket fördelaktigt för att detektera transienta proteininteraktioner som är fallet mellan många enzymsubstratinteraktioner och för att kartlägga Spatiotemporal protein-protein Interactions inom definierade strukturer som har genomförts för centrosom och cilier 26,28.

To investigate the cellular function of an uncharacterized protein it is important to determine its in vivo spatiotemporal subcellular localization and its interacting protein partners. Traditionally, single and tandem epitope tags fused to the N or C-terminus of a protein of interest have been used to facilitate protein localization and protein interaction studies. For example, the tandem affinity purification (TAP) technology has enabled the isolation of native protein complexes, even those that are in low abundance, in both yeast and mammalian cell lines1,2. The localization and affinity purification (LAP) technology, is a more recent development that modifies the TAP procedure to include a localization component through the introduction of the green fluorescent protein (GFP) as one of the epitope tags3. This approach has given researchers a deeper understanding of a protein's subcellular localization in living cells while also retaining the ability to perform TAP complex purifications to map protein-protein interaction networks. 
However, there are many issues associated with the use of TAP/LAP technologies that has hampered their widespread use in mammalian cells. For example, the length of time that is necessary to generate a stable cell line expressing a TAP/LAP tagged protein of interest; which typically relies on cloning the gene of interest into a viral vector and selecting single cell stable integrants with the desired expression level. Additionally, many cellular pathways are sensitive to constitutive protein overexpression (even at low levels) and can arrest cells or trigger cell death over time making the generation of a TAP/LAP stable cell line impossible. These and other constraints have impeded LAP/TAP methodologies from becoming high-throughput systems for protein localization and protein complex elucidation. Therefore, there has been considerable interest in the development of an inducible high-throughput LAP-tagging system for mammalian cells that takes advantage of current innovations in cloning and cell line technologies. 
Here we present a protocol for generating stable cell lines with Doxycycline/Tetracycline (Dox/Tet) inducible LAP-tagged proteins of interest that applies advances in both cloning and mammalian cell line technologies. This approach streamlines the acquisition of data with regards to LAP-tagged protein subcellular localization, protein complex purification and identification of interacting proteins4. Although affinity proteomics utilizes a wide range of techniques for protein complex elucidation5, our approach is beneficial for expediting the identification of these complexes and their native interaction networks and is amenable to high-throughput protein tagging that is necessary to investigate complex biological pathways that contain a multitude of protein constituents. Key to this approach are advancements in cloning strategies that enable high fidelity and expedited cloning of target genes into an array of vectors for gene expression in vitro, in various organisms like bacteria and baculovirus, and in mammalian cells6,7. Additionally, the ORFeome collaboration has cloned thousands of sequence validated open reading frames in vectors that incorporate these advances in cloning, which are available to the scientific community8-11. In our system, the pGLAP1 LAP-tagging vector enables the simultaneous cloning of a large number of clones, which facilitates high-throughput LAP-tagging. This expedited cloning procedure is coupled to a streamlined approach for generating cell lines with LAP-tagged genes of interest inserted at a single pre-determined genomic locus. This makes use of cell lines that contain a single flippase recognition target (FRT) site within their genome, which is the site of integration for LAP-tagged genes. These cell lines also express the tetracycline repressor (TetR) that binds to Tet operators (TetO2) upstream of the LAP-tagged genes and silences their expression in the absence of Dox/Tet. This allows for Dox/Tet inducible expression of the LAP-tagged protein at any given time. Having the capability of inducible LAP-tagged protein expression is critical, since many cellular pathways are sensitive to the levels of critical proteins governing the pathway and can arrest cell growth or trigger cell death when these proteins are constitutively overexpressed, even at low levels, making the generation of non-inducible LAP-tagged stable cell lines impossible12.

<table border="0" cellpadding="0" cellspacing="0" width="640">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Flp-In T-REx Core Kit</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">K6500-01</td>
			<td style="width:167px;">Kit for generating cell lines that contain an FRT site and TrtR expression</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-734</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 2.5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-420</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cell stackers</td>
			<td style="width:139px;">Corning CellSTACK</td>
			<td style="width:119px;">3271</td>
			<td>Cell stacker for growing cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">500 mL conical centrifuge tubes</td>
			<td style="width:139px;">Corning&#160;</td>
			<td style="width:119px;">431123</td>
			<td>Tubes for harvesting cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-GFP antibody</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td>Rabbit anti GFP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Affiprep Protein A beads</td>
			<td style="width:139px;">Biorad</td>
			<td style="width:119px;">156-0006</td>
			<td>Used as a matrix for conjugating anti-GFP antibodies</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dimethylpimelimidate (DMP)</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td>21667</td>
			<td>Used for conjugating anti-GFP antibodies to Protein A beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TLA100.3 tubes</td>
			<td style="width:139px;">Beckman</td>
			<td style="width:119px;">349622</td>
			<td>Tubes for centrifuging protein lysates during the clearing step</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TEV protease</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">12575-015</td>
			<td>Used for cleaving the GFP tag off of N-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Precession Protease</td>
			<td style="width:139px;">GE Healthcare</td>
			<td style="width:119px;">27-0843-01</td>
			<td>Used for cleaving the GFP tag off of C-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">S-protein agarose</td>
			<td style="width:139px;">Novagen</td>
			<td style="width:119px;">69704</td>
			<td>Used as a second affinity matrix during the purification of LAP-tagged protein complexes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick DNA gel extraction kit</td>
			<td style="width:139px;">Qiagen</td>
			<td>28704/28706</td>
			<td>For use in purifying PCR products from an agarose gel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BP clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11789020</td>
			<td>Used for cloning ORF PCR products into the pDONR221 shuttle vector</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LR clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11791020</td>
			<td>Used for cloning the ORF of the gene of interest into the pGLAP1 LAP-tagging vector</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">ccdB Survival 2 T1R E. coli</td>
			<td style="width:139px;">Invitrogen</td>
			<td>A10460</td>
			<td>Used for propgating shuttle vectors and pGLAP empty vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fugene 6</td>
			<td style="width:139px;">Promega</td>
			<td>E2691</td>
			<td>Transfection reagent for transfecting vectors into human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">Q100-19</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Doxycycline</td>
			<td style="width:139px;">Clontech</td>
			<td style="width:119px;">631311</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hygromycin B</td>
			<td style="width:139px;">Invitrogen</td>
			<td>10687010</td>
			<td>Drug for selecting stable LAP-tagged integrants</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:139px;">Corning</td>
			<td>61-176-RG</td>
			<td>Drug for selecting Kanamycin resistant bacterial colonies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:139px;">Fisher</td>
			<td>BP1760-5</td>
			<td>Drug for selecting Ampicillin resistant bacterial colonies</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">4-20% Tris Glycine SDS-PAGE gels</td>
			<td style="width:139px;">Biorad</td>
			<td>4561094</td>
			<td>Used for separating protein samples and final LAP-tag purification eluates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Silver Stain Plus Kit</td>
			<td style="width:139px;">Biorad</td>
			<td>1610449</td>
			<td>Used for silver staining the eluates of LAP-tagged pufications and samples collected throughout the purification process&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Coomassie Blue stain</td>
			<td style="width:139px;">Invitrogen</td>
			<td>LC6060</td>
			<td>Used for staining SDS-PAGE gels to visulize LAP-tagged purifications and cutting out protein bands, mass spectrometry compatible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Shuttle vector pDONR221</td>
			<td style="width:139px;">Invitrogen</td>
			<td>12536017</td>
			<td>Shuttle vector for cloning the ORFs of genes of interest</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Flippase expressing vector pOG44</td>
			<td style="width:139px;">Invitrogen</td>
			<td>V600520</td>
			<td>Vector that expresses the Flippase recombinase for integrating LAP-tagged genes into the genome of FRT site containing cell lines</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Platinum Taq DNA Polymerase</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td style="width:119px;">10966018</td>
			<td>Used for PCR amplification of the ORFs of genes of interest</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4X Laemmli sample buffer</td>
			<td style="width:139px;">Biorad</td>
			<td>1610747</td>
			<td>Sample buffer for eluting purified LAP-tagged protein complexes from the bead matrix</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria broth (LB) media</td>
			<td style="width:139px;">Fisher</td>
			<td>BP9723-2</td>
			<td>Used for growing DH5&#945; bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNA miniprep kit</td>
			<td style="width:139px;">Promega</td>
			<td>A1222</td>
			<td>Used for making DNA plasmid minipreps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM/F12 media</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30023.01</td>
			<td>For growing Hek293 human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS lacking Tet</td>
			<td style="width:139px;">Altanta Biologicals</td>
			<td>S10350</td>
			<td>Used for making -Tet DMEM/F12 media for generating and growing inducible LAP-tagged stable cell lines</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30042.01</td>
			<td>For lifting Hek293 cell foci from plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease inhibitor tablets</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11836170001</td>
			<td>Used for making protocol buffers, EDTA-free</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">10% nonyl phenoxypolyethoxylethanol&#160;</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11332473001</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td style="width:139px;">Corning</td>
			<td>21-040-CM</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween-20</td>
			<td style="width:139px;">Fisher</td>
			<td>BP337-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Borate</td>
			<td style="width:139px;">Fisher</td>
			<td>S249-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td style="width:139px;">Fisher</td>
			<td>A78-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanolamine</td>
			<td style="width:139px;">Calbiochem</td>
			<td>34115</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td style="width:139px;">Fisher</td>
			<td>P217-3</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KCl</td>
			<td style="width:139px;">Fisher</td>
			<td>BP358-10</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td style="width:139px;">Fisher</td>
			<td>BP172-25</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgCl2</td>
			<td style="width:139px;">Fisher</td>
			<td>M33-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris base</td>
			<td style="width:139px;">Fisher</td>
			<td>BP152-5</td>
			<td>Used for making protocol buffers</td>
		</tr>
	</tbody>
</table>

inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this principle, the purification of critical proteins required for the functioning of these pathways along with their native interacting partners has not only allowed the mapping of the protein constituents of these pathways, but has also provided a deeper understanding of how these proteins coordinate to regulate these pathways. Within this context, understanding a protein's spatiotemporal localization and its protein-protein interaction network can aid in defining its role within a pathway, as well as how its misregulation may lead to disease pathogenesis. To address this need, several approaches for protein purification such as tandem affinity purification (TAP) and localization and affinity purification (LAP) have been designed and used successfully. Nevertheless, in order to apply these approaches to pathway-scale proteomic analyses, these strategies must be supplemented with modern technological developments in cloning and mammalian stable cell line generation. Here, we describe a method for generating LAP-tagged human inducible stable cell lines for investigating protein subcellular localization and protein-protein interaction networks. This approach has been successfully applied to the dissection of multiple cellular pathways including cell division and is compatible with high-throughput proteomic analyses.

För att belysa användbarheten av detta system, var den öppna läsramen (ORF) av Tau mikrotubuli-bindande protein klonades in i skyttelvektorn genom amplifiering av Tau ORF med primrar innehållande attB1 och attB2-ställen (tabell 1) och inkubering av PCR-produkter med den skyttelvektor och ett rekombinas som medierar insättning av PCR-produkter in i skyttelvektorn. Reaktionsprodukterna användes för att trans DH5a-bakterier 13 och plasmid-DNA från Kanamycinresistenta kolonier sekvenserades för att säkerställa Tau införing. En sekvens validerad shuttle-Tau vektorn användes sedan för att överföra Tau ORF in i pGLAP1 vektor, vilken sammansmält Tau i ram med LAP (EGFP-TEV-S-protein) tag, genom inkubering skytteln-Tau vektorn med pGLAP1 vektorn och rekombinas som förmedlar överföringen av ORF från skyttelvektorn till pGLAP1. Reaktionsprodukterna användes för att transformera DH5a bakterier13 och plasmid-DNA från ampicillinresistenta kolonier sekvenserades för att säkerställa att den LAP-Tau-fusions var i ram. Sekvens validerade pGLAP1-LAP-Tau ades sedan samtransfekteras med en vektor som uttrycker flippas rekombination enzymet i HEK293-celler som innehöll en enda flippas igenkännings mål (FRT) site inom deras genom, som är platsen för integrationen för LAP-taggade gener 14. Denna cellinje uttryckte också TetR som binder till Tet operatörer uppströms om LAP-märkta gener och tystar deras uttryck i frånvaro av Tet / Dox. Stabila integranter selekterades med -Tet DMEM / F12-medium med 100 | j, g / ml Hygromycin i 5 dagar. Individuella hygromycin resistenta cell foci skördades genom tillsats av 20 | il av trypsin på topp och pipettera upp och ned 2 gånger. Cellerna placerades i en 24-brunnsplatta och expanderas genom kontinuerlig tillväxt i -Tet DMEM / F12-medium. För att verifiera att Hygromycin resistenta cells var i stånd att uttrycka LAP-Tau, var HEK293 LAP-Tau-celler inducerades med 0,1 | j, g / ml Dox under 15 timmar och proteinextrakt framställdes från icke-inducerade och Dox-inducerade celler. Dessa extrakt separerades med SDS-PAGE, överfördes till ett PVDF-membran, och immunblott för GFP och tubulin som laddningskontroll. Såsom framgår av fig 4A, LAP-Tau (visualiseras med anti-GFP-antikroppar) var endast uttrycks i närvaro av Dox. Att validera att LAP-Tau var korrekt lokaliserad till mitotiska mikrotubuli spindel under mitos, som hade tidigare visats för endogen Tau 18, var HEK293 LAP-Tau celler inducerade med 0,1 mikrogram / ml Dox under 15 timmar och cellerna fixerades med 4% paraformaldehyd och co-färgades för DNA (Hoechst 33342) och mikrotubuli (anti-tubulin antikroppar). Konsekvent, var LAP-Tau lokaliserad till den mitotiska spolen under metafas av mitos (figur 4B). För att verifiera att LAP-Tau och dess interagerande proteiner kan renas med detta system, HEK293 LAP-Tau-celler odlades i rullflaskor till ~ 70% konfluens, inducerades med 0,1 | j, g / ml Dox i 15 h, skördades genom omrörning, lyserades med LAP300-buffert, och LAP-Tau renades med användning av ovanstående protokoll. Eluaten från LAP-Tau rening upplöstes genom SDS-PAGE och gelén silverfärgades. Figur 4C visar den LAP-Tau rening, markerade med en asterisk är LAP-Tau och flera andra band som indikerar Tau interagerande proteiner kan ses. <img alt="Figur 1" src="/files/ftp_upload/54870/54870fig1.jpg" /> Figur 1: Översikt över Generation av LAP-märkta Inducerbara stabila cellinjer för varje protein av intresse. Den öppna läsramen (ORF) av gener av intresse amplifieras med attB1 och attB2 ställen som flankerar 5 &#39;och 3&#39; ändsekvensema, respektive (primersekvenser ges i Tabell 1) och klonas in i<html> skyttelvektorn. Sekvensverifierades skyttelvektorer med genen av intresse används sedan för att överföra genen av intresse in i pGLAP1 vektorn. Sekvensen verifierades pGLAP1 vektorn med genen av intresse är samtransfekterades sedan med vektorn som innehåller den flippas rekombinas till den önskade cellinje som innehåller en enda flippas igenkännings mål (FRT) site inom deras genom, som är platsen för integrationen för LAP -märkt gener. Dessa cellinjer uttrycker också Tet-repressorn (TetR) som binder till Tet operatörer (TetO 2) uppströms om LAP-märkta gener och tystar deras uttryck i frånvaro av Tet / Dox. LAP-märkta genen av intresse därefter rekombineras in i FRT-säte och stabila integranter väljs med hygromycin. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig1large.jpg" target="_blank">Klicka här för att se en större version av denna siffra.</a> <html> 2 &quot;src =&quot; / filer / ftp_upload / 54870 / 54870fig2.jpg &quot;/&gt; Figur 2: Översikt över ansökningar om LAP-märkta stabila cellinjer. LAP-taggade inducerbara stabila cellinjer induceras för att uttrycka LAP-märkt protein av intresse genom Dox tillsats och kan synkroniseras i olika stadier av cellcykeln eller kan stimuleras med kemikalier eller ligander för att aktivera vilken som helst önskad signaleringsvägen. Subcellulära lokalisering av den LAP-taggade protein av intresse kan analyseras med levande cell eller fast cell imaging. LAP-märkta proteiner kan också vara tandem affinitetsrenad och deras interagerande proteiner kan identifieras genom vätskekromatografi tandemmasspektrometri (LC-MS / MS). Slutligen kan Cytoscape användas för att generera ett protein-proteininteraktion nätverk av betet proteinet. Dox visar doxycyklin, IP indikerar immunoprecipitat, EGFP indikerar förbättrade grönt fluorescerande protein, Tev indikerar TEV proteas klyvningsställe, och S anger S-tag.http://ecsource.jove.com/files/ftp_upload/54870/54870fig2large.jpg &quot;target =&quot; _ blank &quot;&gt; Klicka här för att se en större version av denna siffra. <img alt="Figur 3" src="/files/ftp_upload/54870/54870fig3.jpg" /> Figur 3: Översikt över LAP-märkt Protein Expression, Purification och förberedelse för masspektrometri. Protokollet har 9 steg: 1) tillväxt och induktion av LAP-märkta proteinuttryck, 2) cell skörd och lys, 3) förberedelse av lysat, 4) bindning av lysat till anti-GFP pärlor, 5) TEV proteas klyvning av GFP-taggen, 6) bindning av lysat till S-protein pärlor, 7) eluering av betet protein och interagerande proteiner, och 8-9) beredning av prover för masspektrometri-baserad proteomik analyser. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig3large.jpg" target="_blank">Klicka här för att se en större version av denna siffra.</a> </p&gt; <img alt="figur 4" src="/files/ftp_upload/54870/54870fig4.jpg" /> Figur 4: Kontroll av LAP-Tau-expression. (A) Western blot (WB) analys av proteinprover från icke-inducerade och Dox inducerad LAP-Tau HEK293-celler sonderades med anti-GFP-och anti-tubulin-antikroppar för att detektera LAP-taggade Tau-protein och tubulin laddningskontroll, respektive. Notera att LAP-Tau uttrycks endast när cellerna inducerades med Dox. (B) Mitotiska celler som uttrycker LAP-Tau fixerades och co-färgades för DNA (Hoechst 33342) och tubulin (Tub) med anti-tubulin-antikroppar och subcellulära lokalisering av LAP-tau analyserades genom fluorescens microcopy. Observera att LAP-Tau lokaliseras till de mitotiska spindel och spindel stolpar under mitos. (C) Silver färgad gel av LAP-Tau rening. MW indikerar molekylvikt, CL indikerar rensas lysat, och E indicrar slutliga eluat. Prover kördes på en 4-20% SDS-PAGE och gelén silverfärgades för att visualisera de renade proteinerna. Notera att ett band motsvarande LAP-Tau är markerad med en asterisk och flera andra band som motsvarar samar rening av proteiner kan ses. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig4large.jpg" target="_blank">Klicka här för att se en större version av denna siffra.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> N-terminal fusion </td><td></td></tr><tr><td> Framåt </td><td> 5&#39;GGGGACAAGT TTGTACAAAAAAGCAGGCT TCATG - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> Omvänd </td><td> 5&#39;GGGGACCACTTTGTACAAGAAAGCTGGGT T TTATCA - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> C-terminal fusion </td><td></td></tr><tr><td> Framåt </td><td> 5&#39;- GGGGACAAGTTTGTACAAAAAAGCAGGCT TCACC - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> Omvänd </td><td> 5&#39;GGGGACCACTTTGTACAAGAAAGCTGGGT G - (&gt; 18gsn) -3 &#39; </td></tr></tbody></table> Tabell 1: Framåt och bakåt Primers för att förstärka ORF eller Intresset för Insättning i skyttelvektorn. AttB-ställena är markerade med fet stil betecknar GSN att mer än 18 genspecifika nukleotider läggs till primern. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> Steg </td><td> Temperatur </td><td> Tid </td></tr><tr><td colspan="2"> initial denaturering </td><td> 94 ° C </td><td> 2 min </td></tr><tr><td rowspan="3"> PCR amplifieringscykler (35) </td><td> Denaturera </td><td> 94 ° C </td><td> 30 sek </td></tr><tr><td> Glödga </td><td> 55 ° C (beroende på primern Tm) </td><td> 30 sek </td></tr><tr><td> Förlänga </td><td> 72 ° C </td><td> 1 min / kb </td></tr><tr><td colspan="2"> Håll </td><td> 4 ° C </td><td> obegränsat </td></tr></tbody></table> Tabell 2: PCR-betingelser för amplifiering av ORF av intresse. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Vektor </td><td> Forward sekvenseringsprimer </td><td> Omvänd sekvenseringsprimer </td></tr><tr><td> skyttelvektor </td><td> 5&#39;-TGTAAAACGACGGCCAGT-3 &#39; </td><td> 5&#39;-CAGGAAACAGCTATGAC-3 &#39; </td></tr></tbody></table> Tabell 3: framåt och bakåt sekvenseringsprimrar för skyttelvektorn. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> ID </td><td> Strukturera </td><td> Parental </td><td> Promotor </td><td> bac Res </td><td> Mam Res </td><td> Tet reg? </td></tr><tr><td> pGLAP1 </td><td> N-term EGFP-TEV-S-peptiden </td><td> pcDNA5 / FRT / TILL </td><td> CMV </td><td> amp </td><td> hyg </td><td> Ja </td></tr><tr><td> pGLAP2 </td><td> N-term Flag-TEV-S-peptiden </td><td> pcDNA5 / FRT / TILL </td><td> CMV </td><td> amp </td><td> hyg </td><td> Ja </td></tr><tr><td> pGLAP3 </td><td> N-term EGFP-TEV-S-peptid; C-term V5 </td><td> PEF5 / FRT-V5 </td><td> EF1a </td><td> amp </td><td> hyg </td><td> Nej </td></tr><tr><td> pGLAP4 </td><td> N-term Flag-TEV-S-peptid; ; C-term V5 </td><td> PEF5 / FRT-V5 </td><td> EF1a </td><td&gt; Amp </td><td> hyg </td><td> Nej </td></tr><tr><td> pGLAP5 </td><td> C-term S-peptid-PreProt x2-EGFP </td><td> PEF5 / FRT-V5 </td><td> EF1a </td><td> amp </td><td> hyg </td><td> Nej </td></tr></tbody></table> Tabell 4: Lista över tillgängliga LAP / TAP vektorer med variabla Promotorer epitop-taggar och Dox inducerbart uttryck resurser för N eller C-terminal protein märkning. Vektorer är kommersiellt tillgängliga. Bac Res indikerar resistensmarkör, Mam Res indikerar däggdjursceller resistensmarkör, Tet reg? anger om uttrycket är Tet / Dox reglerbar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Vektor </td><td> Forward sekvenseringsprimer </td><td> Omvänd sekvenseringsprimer </td></tr><tr><td> pGLAP1 </td><td> 5&#39;-ATCACTCTCGGCATGGACGAGCTGTACAAG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP2 </td><td> 5&#39;-CGAACGCCAGCACATGGACAGGG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP3 </td><td> 5&#39;-AGAAACCGCTGCTGCTAA-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP4 </td><td> 5&#39;-AGACCCAAGCTGGCTAGGTAAGC-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP5 </td><td> 5&#39;-CGTAATACGACTCACTATAG-3 &#39; </td><td> 5&#39;-TCCAGGGTCAAGGAAGGCACGG-3 &#39; </td></tr></tbody></table> Tabell 5: framåt och bakåt sekvenseringsprimrama för pGLAP vektorer.

Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks.

Inducerbara LAP-märkta stabila cellinjer för att undersöka proteiners funktion, Spatiotemporal Lokalisering och proteininteraktioner nätverk

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this ...

The overall goal of this procedure is to generate inducible localization and affinity purification, or LAP-tagged stable cell lines, for investigating protein function, spatiotemporal localization, and protein interaction networks. This method can help answer key questions in molecular and cell biology related to protein function, protein cell cycle subzero localization, and protein interactions. The main advantage of this method is that it is amenable to high throughput analysis of groups of proteins, and can be used to dissect the protein components of biological pathways.To begin this procedure, clone the open reading frame of the gene of interest into the LAP-tagged vector and transfect it into HEK293 cells as described in the text protocol. One day post-transfection, replace the minus Tet DMEM/F12 media with fresh media. Two days post-transfection, split the cells to 25%confluence.Allow the cells approximately five hours to attach. Then, add hygromycin-containing minus Tet DMEM/F12 media at the predetermined concentration. For HEK293 cells, use 100 micrograms per milliliter hygromycin.Replace the media as needed until distinct cell foci appear that resemble opaque spots against the transparent plate. Add 20 microliters of trypsin on top of each cell foci and pipe it up and down two times with a 200 microliter pipette tip. Transfer the cells in a 24-well plate and expand the cells by continual growth in hygromycin-containing minus Tet DMEM/F12 media.Expand the validated LAP-tagged cell line for tandem affinity purification, or TAP, isolation of protein complexes. To do so, continually passage all the HEK293 cells into larger plates and/or roller bottles, and minus Tet DMEM/F12 media at 37 degrees Celsius and five percent carbon dioxide. For Tet/Dox inducible cell lines, induce the cells for 10 to 15 hours by adding a concentration of 0.2 micrograms per milliliter Tet/Dox when the cells reach approximately 70%confluency.Harvest the cells by agitation or trypsinization. Then, pellet them at 875 times g for five to 10 minutes. To couple the anti-GFP antibody to protein A beads, equilibrate 160 microliters of packed volume protein A beads with PBST in a 1.5 milliliter tube.Wash the beads three times with 1 milliliter of PBST. Following each wash step throughout this procedure, the beads are centrifuged at 5000 times g for 10 seconds, and the supernatant is removed. After re-suspending the beads in 500 microliters of PBST, add 80 micrograms of affinity purified rapid anti-GFP antibody to each tube, containing 160 microliters of beads.Mix for one hour at room temperature. Wash the beads two times with one milliliter of PBST, then wash the beads two times with one milliliter of 0.2 molar sodium borate, pH After the final wash, add 900 microliters of the sodium borate buffer, to bring the final volume to one milliliter. Then, add 100 microliters of 220 molar DMP to the bead suspension, for a final concentration of 20 millimolar.Rotate the tubes gently at room temperature for 30 minutes. After incubation with DMP, wash the beads one time with one milliliter of 0.2 molar ethanolamine, 0.2 molar sodium chloride pH 8.5, to inactivate the residual crosslinker. Then, re-suspend the beads in one milliliter of the same buffer, and rotate for one hour at room temperature.After pelleting the beads, re-suspend them in an additional 500 microliters of the buffer. The prepared beads are stable for several months at four degrees Celsius. To prepare the cell lysates, re-suspend 500 microliters of packed cell volume into 2.5 milliliters of LAP 300, with 0.5 millimolar DTT and protease inhibitors.Add 90 microliters of 10%nonyl phenoxypolyethoxylethanol, and mix by inversion. Place the mixture on ice for 10 minutes. Centrifuge at 21, 000 times g for 10 minutes.Following centrifugation, collect this low-speed supernatant and set aside a 10 microliter sample for gel analysis. After transferring the low-speed supernatant to a TLA 100.3 tube, spin at 100, 000 times g for one hour at four degrees Celsius. Collect this high-speed supernatant in a tube and place on ice, reserving a 10 microliter sample for gel analysis.For the first affinity capture through binding to anti-GFP beads, pre-elute the antibody-coupled beads by washing them three times with one milliliter of elution buffer to remove the uncoupled antibodies and reduce background. Perform this quickly. Do not leave beads in high salt for a long time.Then, wash the beads three times with one milliliter of LAP 200 N.Next, mix the high-speed supernatant extract with antibody beads for one hour at four degrees Celsius. After centrifuging the extract at 21, 000 times g for 10 minutes, reserve a 10 microliter sample of the supernatant for gel analysis. Perform three quick washes of the beads with one milliliter of LAP 200 N, containing 0.5 millimolar DTT and protease inhibitors.Use the same buffer to wash the beads two additional times with a five minute incubation time for each wash. Then, wash the beads quickly two more times with 1 milliliter of LAP 200 N containing 0.5 millimolar DTT and no protease inhibitors, before adding the Tobacco Etch Virus, or TEV, protease. Add 10 micrograms of the TEV protease in one milliliter of LAP 200 N to the beads, and rotate the tubes at four degrees Celsius overnight.The next day, pellet the beads and transfer the supernatant to a fresh tube. Rinse the beads twice with 160 microliters of LAP 200 N, containing 0.5 millimolar DTT and protease inhibitors to remove any residual protein. For the second affinity capture through binding to S-protein agarose, wash one tube of 80 microliters S-protein agarose slurry three times with one milliliter of LAP 200 N.Add the TEV eluted supernatant to the S-protein beads, and rock them for three hours at four degrees Celsius.After pelleting the beads, wash them three times with one milliliter of LAP 200 N containing 0.5 millimolar DTT and protease inhibitors. Then, wash the beads two times with one milliliter of LAP 100. Elute the proteins off the S-protein agarose by adding 50 microliters of 4x Laemmli sample buffer and heating at 97 degrees Celsius for 10 minutes.To identify interacting proteins by mass spectrometry analysis, test the quality of the purification by analyzing the collected samples by Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis. Silver stain the resulting gel. Also, immunoblot the eluates and probe with anti-GFP antibodies to ensure the LAP-tagged purification worked.To identify stoichiometric and substoichiometric co-purifying species, take the final elution sample and separate it by SDS-PAGE. Stain the gel with a mass spectrometry compatible protein stain. Excise the most prominent bands in the gel and the space in between them to process the bands separately for analysis by mass spectrometry.Shown here is a representative western blot analysis of the protein samples from non-induced and Dox-induced LAP-Tau HEK293 cells. The cells are probed with anti-Tubulin antibodies to detect the Tubulin loading control, and probed with anti-GFP to detect the LAP-tagged Tau protein. Note that LAP-Tau is only expressed when the cells are induced with Dox.Mytotic cells expressing LAP-Tau were fixed and co-stained for DNA and Tubulin with anti-Tubulin antibodies, and the sub-cellular localization of LAP-Tau was analyzed by fluorescence microscopy. Note that LAP-Tau localizes to the mitotic spindle and spindle poles during mitosis. Shown here is a representative silver stained gel of the LAP-Tau purification.The lanes represent the molecular weight, the cleared lysates, and the final eluates. Samples were run on a 4-20%SDS-PAGE gel and the gel was silver stained to visualize the purified proteins. Note that a band corresponding to LAP-Tau is marked with an asterisk, and several other bands corresponding to co-purifying proteins can be seen.After watching this video, you should have a good understanding of how to generate inducible LAP-tagged stable cell lines, and how to perform biochemical purifications of LAP-tagged proteins for proteomic analysis and identification of protein interaction networks.

Research

JoVE Journal

Biology

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

Färgning av proteinerna i geler med Coomassie G-250 utan organiska lösningsmedel och ättiksyra

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

Använda GELFREE 8100 Fraktionering System för Molekylär viktbaserad fraktionering med vätskefasen Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Bimolecular Fluorescence Complementation (BiFC) Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

Bimolecular Fluorescence Complementation BiFC Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

Bimolecular Fluorescens komplement (BiFC) analys av protein-protein interaktion i lök celler med Helios Gene Gun

Investigation of gene function in diverse organisms relies on knowledge of how the gene products interact with each other in their normal cellular ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

Generering av stabila humana cellinjer med tetracyklin-inducerbar (Tet-on) shRNA eller cDNA-uttryck

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Investigating Protein-protein Interactions in Live Cells Using Bioluminescence Resonance Energy Transfer

Undersökning av protein-proteininteraktioner i levande celler med hjälp Bioluminescence Resonance Energy Transfer

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live ...

Discovering Protein Interactions and Characterizing Protein Function Using HaloTag Technology

Upptäcka protein interaktioner och karakterisering Protein Funktion med HaloTag Technology

Research in proteomics has exploded in recent years with advances in mass spectrometry capabilities that have led to the characterization of numerous ...

Identifying Protein-protein Interaction Sites Using Peptide Arrays

Identifiera protein-proteininteraktion webbplatser Använda peptid Arrays

Protein-protein interactions mediate most of the processes in the living cell and control homeostasis of the organism. Impaired protein interactions may ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Grönt fluorescerande protein-baserad expressions Screening av membranproteiner i<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

Selected Reaction Monitoring Mass Spectrometry for Absolute Protein Quantification

Vald Reaction Monitoring masspektrometri för Absolute protein kvantifiering

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Luciferas komplettering Imaging test i Nicotiana benthamiana blad för övergående bestämma Protein-protein interaktioner Dynamics

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...