Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

1. Identificatie van een natuurlijk product met antibiotica Property <ol><li> Cultiveren een micro-organisme onder verschillende omstandigheden (bijvoorbeeld, temperatuur, pH, media) na de &quot;OSMAC (een stam-vele verbindingen) benadering&quot; 13. Selecteer een medium waarin de productie van een verbinding wordt waargenomen. </li><li> Cultiveren Streptomyces diastatochromogenes Tü6028 onder de volgende voorwaarden <ol><li> Grow Streptomyces diastatochromogenes Tü6026 druk op MS platen (sojameel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, leidingwater 1 L). Inoculeer een kleine lus van de sporen van deze stam in 20 ml vloeibare TSB medium (tryptische soja bouillon 30 g, leidingwater 1 L, pH 7,2; voorkweek medium) in een erlenmeyer met een spiraal. Schud de kolf op een roterend schudapparaat (28 ° C, 180 rpm, 2 dagen). </li><li> Inoculeer belangrijkste cultuur in 100 ml HA medium (glucose 4 g, gistextract 4 g, moutextract 10 g, leidingwater 1 L, pH 7,2) met 2 ml van de voorkweek. Kweek de stam bij 28 ° C gedurende 6 dagen op een roterende schudder bij 180 rpm. </li></ol></li><li> Bereiding van het ruwe extract <ol><li> Oogst cellen door centrifugatie (10 min, 3000 x g). </li><li> Voor de volgende stappen te behandelen organische oplosmiddelen onder een zuurkast. </li><li> Voor samengestelde extractie van het mycelium, resuspendeer cellen in een tweevoudige volume aceton toe en schud een buis voor 30 min, 180 rpm. Filtreer de vloeistof door commerciële filtreerpapier en damp aceton door roterende verdamper bij 40 ° C en 550 bar. Los het extract in 20 ml water: ethylacetaat (1: 1) en schud in een scheitrechter gedurende 30 minuten bij 180 rpm. </li><li> Voor samengestelde winning uit het kweekmedium, stel de kweekbouillon tot pH 4,0 door toevoeging van 1 M HCl. Voeg 100 mL ethylacetaat en schud in een scheitrechter gedurende 30 min, 180 rpm. </li><li> Verzamel ethylacetaatfase en verdampen door rot<html> ary verdamping bij 40 ° C en 240 bar. </li></ol></li><li> Analyse van het ruwe extract met HPLC <ol><li> Los de extracten in 1 ml MeOH, filteren door een 0,45 um poriegrootte filter en run High-Performance Liquid Chromatography (HPLC) 14. </li><li> Bij polyketomycin, rust de HPLC systeem met een C18 voorkolom (4,6 x 20 mm 2) en een C18-kolom (4,6 x 100 mm 2). Gebruik een lineaire gradiënt van acetonitril + 0,5% azijnzuur varieert van 20% tot 95% in H2O + 0,5% azijnzuur (stroomsnelheid: 0,5 ml min -1). OPMERKING: Polyketomycin heeft een retentietijd van 25,9 min (zie figuur 1A). Het UV / VIS spectrum maxima bij 242 nm, 282 nm, 446 nm en minima bij 262 nm en 359 nm (zie figuur 1B). In de negatieve modus een massa van 863,2 [MH] - detecteerbaar is (zie figuur 1C). </li></ol></li></ol>&quot;Src =&quot; / files / ftp_upload / 54952 / 54952fig1.jpg &quot;/&gt; Figuur 1: LC / MS analyse van Polyketomycin. (A) HPLC chromatogram (λ = 430 nm) van het ruwe extract na kweken van Streptomyces diastatochromogenes Tü6028 gedurende 6 dagen. Polyketomycin heeft een retentietijd van 25,9 min (B) UV / Vis spectra van Polyketomycin. (C) Massa spectra van Polyketomycin in de negatieve modus. Belangrijkste piek met m / z 863,2 [MH] -. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig1large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a> <ol start="5"><li> Identificatie van het antibioticum activiteit met disc diffusion assay <ol><li> Inoculeer testen stammen, zoals Gram-positieve bacterie Bacillus subtilis (in LB-medium; LB 20 g, leidingwater 1 L, pH 7,4) en andere Streptomyces stammen (in TSB-medium; tryptische soja bouillon 30 g, leidingwater 1 L, pH 70,2), Gram-negatieve bacterie Escherichia coli (in LB-medium) en schimmelstammen (in media zoals YPD medium gistextract 10 g, 20 g pepton, glucose 20 g, leidingwater 1 L, pH 7,4). Neem 100 ul van de test stam precultuur en verdeel ze op respectievelijke agarplaten. </li><li> Ontbinding van de ruwe extract of gezuiverde verbinding in 500 ul van methanol (alternatief water of DMSO) en pipet 20-50 pi op steriele papier schijven. Droog papier schijven gedurende 30 minuten onder de werkbank en leg ze op de platen met testculturen. Bereid een negatieve controle (oplosmiddel) en een positieve controle (antibioticum, bijv apramycin [1 mg]). </li><li> Incubeer de platen onder passende voorwaarden, totdat de test stammen zichtbaar worden gekweekt en het bepalen van de remming zone, indien duidelijk. Incubeer E. coli en Bacillus sp. bij 37 ° C gedurende 16 uur, Streptomyces sp. bij 28 ° C gedurende 2-4 dagen, schimmelstam (hoofdzaak op exact test stam) eent 30 ° C gedurende 2 dagen). </li></ol></li></ol> 2. Large Scale Winning, zuivering en structuuropheldering van de verbinding <ol><li> Cultiveren S. diastatochromogenes in 5 L HA medium (glucose 4 g, gistextract 4 g, mout extract 10 g, leidingwater 1 L, pH 7,2). Inoculeer 2 ml van de voorkweek in 30 x 500 ml erlenmeyers die 150 ml HA medium. Incubeer de stam bij 28 ° C gedurende 6 dagen op een roterende schudder bij 180 rpm. </li><li> Oogst cellen door centrifugeren (10 minuten, 15.000 xg, RT) en extract verbindingen met behulp van ethylacetaat (zie paragraaf 1.3). </li></ol><img alt="Figuur 2" src="/files/ftp_upload/54952/54952fig2.jpg" /> Figuur 2: Workflow voor structuuropheldering. De werkwijze omvat (1) het kweken van de stam, (2) extractie, (3) zuivering door vastefase-extractie (SPE), dunnelaagchromatografie (TLC), preparatieve vloeistofchromatografie (HPLC), grootteuitsluitingschromatografie (SEC) en (4) structuuropheldering massa-analyse (MS), kernmagnetische resonantie (NMR) en X-ray metingen. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig2large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a> <ol start="3"><li> Zuivering van Polyketomycin Opmerking: Het proces van zuivering en structuuropheldering is weergegeven in figuur 2. <ol><li> Fractioneren ruw extract van een kolom C18 vastefase-extractie (SPE) met een 10% -stepwise MeOH gradiënt van 30% tot 100% MeOH in H 2 O, 100 ml voor elke conditie. </li><li> Zuiver de verbinding bevattende fractie verder door preparatieve dunnelaagchromatografie (TLC) 15 middels CH 2Cl 2 / MeOH (7: 1) als eluens systeem. </li><li> Zuiver de verbinding door middel van preparatieve HPLC 16. Rust de HPLC systeem met een C18 voorkolom (5 urn, 9,4 x 20 mm) en eenhoofdkolom (5 urn, 9,4 x 150 mm). Met een gradiënt van acetonitril + 0,5% azijnzuur varieert van 20% tot 95% in H2O + 0,5% azijnzuur (stroomsnelheid: 2,0 ml / min). </li><li> Oplosmiddelen en andere kleine verontreinigingen te verwijderen, voert een laatste zuiveringsstap door gelpermeatiechromatografie onder toepassing van een kolom in MeOH 17. Verzamel de uiteindelijke zuivere verbinding en damp MeOH door roterende verdamping bij 40 ° C en 240 bar. </li></ol></li><li> structuuropheldering <ol><li> Los het zuivere verbinding (meer dan 2 mg) in 600-700 gl (afhankelijk van de machine) van DMSO-d6, opnemen 1D NMR (1 H, 13 C) en 2D NMR (HSQC, HMBC, 1 H 1 H COSY) spectra op een NMR-spectrometer 18. Drukken chemische verschuivingen in δ waarden (ppm) met DMSO-d6. </li><li> Neem een hoge-resolutie massaspectrum (HRESI-MS) 19 van polyketomycin behulp van een hoge-resolutiemassaspectrometer. </li><li> Ophelderen van de structuur door interpretatie van de resultaten van NMR en MS gegevensanalyse 10. </li></ol></li></ol> 3. Voorstellen Biosynthetisch Model van de Nieuwe geïsoleerde Compound <ol><li> Analyseer de structuur van de geïsoleerde verbinding en voorspellen enzymen, die kunnen worden betrokken bij de biosynthese. Toewijzen aan polyketide (type I, II of III), niet-ribosomale peptide synthese lantipeptide, terpenoïde of suikermetabolisme traject 8. </li><li> voorbeeld polyketomycin <ol><li> Splits de structuur in de hand liggende enkele groepen: tetracyclische deel, twee mono- en de dimethyl salicylzuur. </li><li> Informatie, waarbij de eenheden worden afgeleid uit: De tetracyclische eenheid kan voortvloeien uit een polyketide synthase type II en dimethyl salicylzuur groep kan worden verkregen door een iteratieve polyketide synthase Type I. De twee suikereenheden, die 6-deoxysugars zijn kan worden synthesized van glucose met een TDP-glucose-4,6-dehydratase tijdens biosynthese en waarschijnlijk verbonden door twee glycosyltransferasen (zie figuur 3) 8. </li><li> Voorspel vermeende genen in het cluster. Denk aan enzymen die betrokken zijn bij de synthese van de enkele groepen in aansluiting van de apparaten en bij het modificeren en afstemmen van de molecule. De biosynthetische gencluster van Polyketomycin bevat waarschijnlijk genen die coderen voor een polyketide synthase type II (dus minimaal een ACS, KS α und KS β voor het aansluiten van extender eenheden), een iteratieve het type polyketide synthase I (althans ACP, AT, KS), een TDP-glucose-4,6-dehydratase (noodzakelijk voor stap: glucose → deoxyglucose) en twee glycosyltransferases (vastmaken twee suiker monomeren aan het aglucon) 8. </li></ol></li></ol><img alt="figuur 3" src="/files/ftp_upload/54952/54952fig3.jpg" /> Figuur 3: Structuur van Polyketomycin Divided in enkele Building Blocks. Polyketomycin bestaat uit een tetracyclische decaketid (PKS type II) en dimethyl salicylzuur (iteratief PKS type I) toegevoegd door de twee groepen deoxysugar β-D-amicetose en α-L-axenose (NDP glucose-4,6- dehydratase en twee glycosyltransferase vereist). <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig3large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a> 4. Genome Sequencing / Mijnbouw <ol><li> Next generation sequencing <ol><li> Sequentie van het genomische DNA van next generation sequencing technologieën zoals Illumina, 454 pyrosequencing of vast 20. Lijn één leest met een referentie sequentie of assembleren de novo. LET OP: Het genoom van S. diastatochromogenes Tü6028 werd de sequentie van het Center for Biotechnology (CeBiTec) aan de Universiteit van Bielefeld. Alle leest werden samengevoegd tot een ontwerp-genoomvan 7,9 Mb. </li></ol></li><li> Genome mining <ol><li> Zoeken naar open reading frames (ORF) door het gebruik van bijvoorbeeld NCBI Prokaryote genoomannotatie Pipeline 21,22, RAST (snelle annotatie met behulp van technologie van het subsysteem) 23,24,25, Prokka (snelle prokaryote genoomannotatie) 26 of GenDB 27. Deze programma&#39;s stellen ook hun functies. De analyse van de S. diastatochromogenes Tü6028 ontwerp genoomsequentie geleid tot de identificatie van meer dan 7000 ORFs. </li><li> Run specifieke BLAST (Basic Local Alignment Search Tool) analyse om meer informatie, zoals groeperingen met andere gelijkaardige genen en katalytische domeinen 28,29,30 te krijgen. </li><li> Voor de identificatie van de secundaire metaboliet gencluster run programma&#39;s zoals antiSMASH 31,32,33, NaPDoS 34 en NRPSpredictor 35,36. In het ontwerp-genoom van Streptomyces diastatochromogenes antiSMASH 31,32,33 identified 22 gen clusters. </li><li> Analyseer de vermeende genclusters hun enzymatische pathway (s) (polyketide synthase (type I, II of III), niet-ribosomale peptide synthetase, lanthipeptide, terpenoïde, suikermetabolisme ...). Zoeken naar cluster (s) die genen die betrokken kunnen worden bij de synthese van de verbinding (zie paragraaf 3). S. diastatochromogenes geannoteerde cluster 2 bevat polyketide synthase genen type II, drie polyketide synthase genen van type I, een TDP-glucose-4,6-dehydratase gen en twee glycosyltransferasegenen (zie figuur 4). </li><li> Focus op enkele genen binnen het cluster. Voor type I PKS en NRPS de specificiteit van acyltransferasen en adenylatie domeinen, en daarmee de opname van één uitbreidereenheden kan worden voorspeld. Vergelijk ook de volgorde van de gebruikte extender eenheid met het molecuul. antiSMASH 31,32,33 toont ook soortgelijke clusters van reeds bekende verbindingen, met een link naar MIBiG databank 37. </li&gt; <li> Vergelijk de structuur van de verbinding met deze andere verbindingen en controleer overeenkomsten. </li></ol></li></ol><img alt="figuur 4" src="/files/ftp_upload/54952/54952fig4.jpg" /> Figuur 4: antiSMASH Output van Polyketomycin Biosynthetisch Gene Cluster en overzicht van andere clusters in S. diastatochromogenes Tü6028. (A) Algemene beschrijving van de voorspelde biosynthetische genclusters in het genoom van S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin biosynthetische gencluster met gerichte genen. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig4large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a> 5. Controle van de Biosynthetisch Gene Cluster <ol><li> Zoeken naar een gen met duidelijke en belangrijke (essentiële) functies biosynthese van de verbinding. Voor de verificatie van de polyketomycin gencluster het gen pokPI, codeert voor het ketosynthase α uit de PKS type II, werd geselecteerd en geïnactiveerd door een uit frame -deletie (zie figuur 5B). Als alternatief, onderbreken het gen door het klonen van een intern fragment (zie figuur 5C). </li></ol><img alt="figuur 5" src="/files/ftp_upload/54952/54952fig5.jpg" /> Figuur 5: Verificatie van een Gene Cluster door Single Crossover. (A) natief gen leidt tot de translatie van een functioneel eiwit; (B) Klonering van het gen met interne deletie in een zelfmoordvector leidt tot een crossover resulteert in een faseverschuiving in het doelgen en vervolgens translatie van niet-functioneel eiwit; (C) Klonering van een intern fragment van het gen in een zelfmoordvector leidt tot afknotting van het gen en daaropvolgende translatie van een niet-functioneel eiwit. oriT: oorsprong van transfer; antibiotica R: antibioticaresistentie. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig5large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a> <ol start="2"><li> Klonen van de single-crossover construct <ol><li> Amplify een fragment dat pokPI door PCR 38 met primers pokPI_for en pokPI_rev. </li><li> Clone PCR product in zelfmoordvector pKC1132 39 (apramycin R [50 mg / ml]). De zelfmoordvector niet kan repliceren in de Streptomyces stam en heeft dus te integreren in het doelgen door homologe recombinatie apramycin-weerstand. Breng de vector in E. coli klonen gastheer door heat shock transformatie 40. </li><li> Isoleer de vector door middel van alkalische lysis 41. </li><li> Digest het vector DNA met een restrictie enzym dat mes knipt binnen het fragment. De pokPI gene werd gedigereerd met enzym KpnI </li><li> Behandel gedigereerd DNA vector met grote DNA-polymerase I (Klenow) fragment, dat 5 &#39;→ 3&#39; polymerase activiteit en 3 &#39;→ 5&#39; exonuclease-activiteit. Afstomping van de overhangende uiteinden en daaropvolgende hernieuwde ligatie leidt tot verlies van vier basen. Controleer op verlies van deze bases stappen transformatie in E. coli XL1 Blue, plukken afzonderlijke kolonies, isoleren van plasmide-DNA ervan, 41 en verdere analyse door middel van restrictiedigestie en sequentiebepaling. </li></ol></li><li> Vervoeging van het single-crossover construct in Streptomyces <ol><li> Breng de zelfmoord vector die het pokPI gen (pKC1132_ pokPI del) met deletie in E. coli ET12567 pUZ8002 42 (kanamycine R) door heat shock transformatie 40. Incubeer de cellen in 100 ml LB-medium (kanamycine 50 ug ml-1, apramycin 50 ug ml -1 </sup&gt;) Overnacht bij 37 ° C. Oogst cellen door centrifugeren (3000 x g, 10 min, 4 ° C) en was cellen tweemaal door resuspenderen in 50 ml LB-medium. Tenslotte hersuspenderen cellen 2 x 500 pi LB media. </li><li> Meng 500 pi E. coli pUZ8002 pKC1132_ pokPI del met 500 pi Streptomyces diastatochromogenes cultuur (als alternatief te gebruiken sporen). Spreid het mengsel over MS platen (sojameel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, leidingwater 1 L). Incubeer de platen gedurende 20 uur bij 28 ° C. </li><li> Overlay elke plaat met apramycin (1,25 mg) en fosfomycin (5 mg) opgelost in 1 ml water en laat ze drogen. Incubeer de platen gedurende enkele dagen bij 28 ° C tot exconjugants zichtbaar. </li></ol></li><li> Controleer single-crossover mutanten <ol><li> Inoculeer één exconjugants in 20 ml TSB-medium (apramycin 50 mg ml-1) en incubeer ze op 28 ° C gedurende drie dagen en 180 rpm.</li><li> Isoleer genoom DNA 43 en controleer of onderbreking van de pokPI-gen door PCR. </li><li> Inoculeer enkele klonen met geverifieerde genonderbreking en Streptomyces wildtype stam in 100 ml HA medium en incubeer ze gedurende 6 dagen bij 28 ° C en 180 rpm. Pak het ruwe extract (zie paragraaf 1.3). Controleer verbinding productie door middel van HPLC-MS-analyse (zie paragraaf 1.4). De overeenkomstige piek in het HPLC-chromatogram en de massa van de verbinding niet meer aantoonbaar zijn (zie figuur 6). </li></ol></li></ol><img alt="figuur 6" src="/files/ftp_upload/54952/54952fig6.jpg" /> Figuur 6: HPLC analyse van S. diastatochromogenes met geïnactiveerde pokPI Gene. HPLC chromatogram (λ = 430 nm) ruw extract van S. diastatochromogenes WT (boven) en mutante stam met onderbroken pokPI Gen. (hieronder). De mutante stam niet meer produceren polyketomycin.<a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig6large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a>

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

In dit laboratorium een genomische cosmide bibliotheek van Streptomyces diastatochromogenes gegenereerd en gescreend vele jaren geleden, resulteerde in identificatie van de polyketomycin gencluster door een zeer tijdrovend proces. Karakterisatie van enkele genen mogelijk met doelgen deleties en analyse van de resulterende mutanten 12. Onlangs heeft een ontwerp-genoom sequentie van S. diastatochromogenes werd verkregen waardoor de snelle identificatie van de polyketomycin biosynthetische gencluster. We konden gemakkelijk te detecteren de biosynthetische genen, hoewel de ontwerp-genoom sequentie bevat nog veel contigs. De beschreven werkwijze kan worden verwezenlijkt in maanden. De procedure omvat veel stappen. Afzonderlijke stappen kan verschillende keren falen, waardoor vooruitgang in de opeenvolgende stappen: Het genus Streptomyces staat bekend om zijn vermogen om bioactieve stoffen te produceren. Terwijl zij hebben vaak meer dan 20 biosynthetic genclusters meestal slechts een of twee verbindingen worden geproduceerd onder laboratoriumomstandigheden. De toepassing van de benadering OSMAC (kweek van een stam onder verschillende omstandigheden) wakker stille genclusters soms niet genoeg. Genetische manipulatie van regulerende genen, zoals genen pleiotrope regulator ADPA 44 en bldA 45,46, is ook een effectieve methode voor de productie van andere secundaire metabolieten activeren. Voor de opheldering van de structuur van de verbinding, bijvoorbeeld door NMR-analyse, gewoonlijk meer dan 2 mg gezuiverde verbinding noodzakelijk. Derhalve wordt de fermentatie van meer dan 10 L kweek vaak vereist. Zonder fermentor die in staat is zuurstof, pH en temperatuur te handhaven, kan het een uitdaging in een kleine laboratorium om deze hoeveelheid cultuur en daaropvolgende extractie behandelen. Tijdens de zuivering kan de verbinding worden veranderd door oxidatie, bestraling en temperatuur.Ook de meer zuiveringsstappen gebruikt, hoe hoger de kans op afbraak. Bij het analyseren van de structuur van het natuurlijke product, en de clusters in het genoom, soms is het niet zo eenvoudig de juiste cluster identificeren. Ten eerste, als er slechts een ontwerp genoomsequentie een deel van het cluster kunnen ontbreken. Ten tweede, niet alle genen die nodig zijn voor de biosynthese van het cluster. Ten derde, soms een cluster wordt gesplitst in twee delen van elkaar gescheiden door vele kilobasen. Ten vierde kan het moeilijk zijn om te beslissen welke de geschikte gencluster. Bij grote letters I PKS of NRPS systemen waar het mogelijk is om het aantal extender eenheden op basis van het aantal modules te berekenen, of zelfs enkele uitbreidereenheden bepalen door analyse van de selectie domeinen blijkt snel op. In het geval van iteratief werkende enzymen de voorspelling van de gesynthetiseerde verbindingen vaak niet mogelijk, zeker als de strain meer dan 40 genclusters. Ten vijfde, de natuur is zeer complex en vol van nog onbekende verbindingen. Vaak is de biosynthese is een mengsel van verschillende trajecten. Als de nieuwe verbinding nog niet is geïdentificeerd of niet samenhangt met een andere verbinding, kan het moeilijk zijn om het cluster te identificeren, een model biosynthese stellen en te bewijzen. Zodra de cluster wordt geïdentificeerd, de enige cross-techniek is een goede en snelle methode om de hypothese te controleren. PCR, kloneren in een zelfmoord vector, vervoeging, de selectie van positieve klonen, en de productie-test zijn de enige vereiste stappen. Een nadeel van deze techniek is dat de integratie van de vector in het chromosoom niet stabiel door verdere recombinatie gebeurtenissen. Derhalve, om een ​​enkel gen verder te analyseren, nauwkeurige gendeleties vereist. Ook kan het lastig zijn om Streptomyces stammen manipuleren op genetisch niveau. De beschreven procedure kan worden toegewezen to andere verbinding die door een Streptomyces stam of ander micro-organisme. De kennis over een biosynthetische gencluster en de gesynthetiseerde verbinding geeft ons meer mogelijkheden om reeds bestaande moleculen te modificeren met het doel deze te verbeteren voor de strijd tegen multiresistente ziekteverwekkers.

Natuurlijke producten uit planten en micro-organismen zijn altijd een belangrijke bron voor de klinische ontwikkeling van geneesmiddelen en onderzoek. De eerste antibioticum penicilline werd ontdekt in 1928 door een schimmel door Alexander Fleming 1. Tegenwoordig worden veel meer natuurlijke producten die worden gebruikt in de klinische behandeling. Eén genus bekend om zijn vermogen om de productie van verschillende soorten secundaire metabolieten met verschillende biologische activiteiten is Streptomyces. Streptomyces zijn Gram-positieve bacteriën en behoren tot de klasse van Actinobacteria en de volgorde Actinomycetales. Bijna tweederde van de klinisch gebruikte antibiotica afgeleid van Actinomycetales, vooral uit Streptomyces, zoals amfotericine 2, daptomycine 3 of 4 tetracycline. Twee Nobelprijzen zijn toegekend op het gebied van Streptomyces antibiotica onderzoek. De eerste naar Selman Waksman voor de ontdekking van streptomycine, de eerste eentibiotic effectief tegen tuberculose. 5 In 2015, als onderdeel van de Nobelprijs voor de Fysiologie en Geneeskunde, de ontdekking van avermectine van S. avermitilis werd ook bekroond. Avermectine wordt gebruikt voor de behandeling van parasitaire ziekten 6,7. De traditionele benadering voor de ontdekking van natuurproducten in micro-organismen zoals Streptomyces omvat in het algemeen het kweken van de stam onder verschillende groeiomstandigheden, alsmede extractie en analyse van secundaire metabolieten. Biologische assays (bijv assays voor antibacteriële en antikanker activiteit) uitgevoerd om de activiteit van de verbinding te detecteren. Tenslotte wordt de verbinding van interesse die de chemische structuur opgehelderd. De structuren van natuurlijke producten zijn vaak samengesteld uit enkelvoudige resten die zich vormen complexe moleculen. Er zijn een paar, maar beperkt, de belangrijkste biosynthetische routes die leiden tot de bouw van blokks, die worden gebruikt voor de biosynthese van natuurlijke producten. De belangrijkste biosynthetische routes zijn de polyketide paden, die leiden tot terpenen en alkaloïden, paden behulp aminozuren, en die leiden tot suikergroepen. Elke route wordt gekenmerkt door een aantal specifieke enzymen 8. Op basis van de structuur van de verbinding, kan deze biosynthetische enzymen worden voorspeld. Tegenwoordig kan de gedetailleerde structurele analyse van een verbinding in combinatie met de volgende generatie sequencing en bioinformatica analyse helpen om de verantwoordelijke biosynthetische gencluster te identificeren. De cluster informatie opent nieuwe mogelijkheden voor verdere natuurlijke product onderzoek. Dit omvat heterologe expressie de opbrengst van het natuurproduct, specifieke chemische modificatie door gendeletie of wijziging en combinatoriële biosynthese met genen van andere routes te verhogen. Polyketomycin werd onafhankelijk geïsoleerd uit de kweekvloeistof vantwee stammen, Streptomyces sp. MK277-AF1 9 en Streptomyces diastatochromogenes Tü6028 10. De structuur werd opgehelderd door NMR en röntgenanalyse. Polyketomycin bestaat uit een tetracyclische decaketid en dimethyl salicylzuur, toegevoegd door de twee groepen deoxysugar β-D-amicetose en α-L-axenose. Het toont cytotoxische en antibiotische activiteit, zelfs tegen Gram-positieve multidrug-resistente stammen zoals MRSA 11. Een genomische cosmide bibliotheek van S. diastatochromogenes Tü6028 werd gegenereerd en gescreend vele jaren geleden. Met behulp van specifieke gen-probes de polyketomycin gen cluster met een grootte van 52,2 kb, met 41 genen, werd geïdentificeerd na enkele maanden van intensief werk 12. Onlangs heeft een ontwerp-genoom sequentie van S. diastatochromogenes werd verkregen die leidt tot de snelle identificatie van de polyketomycin biosynthetische gencluster. In dit overzicht, een methode helpt om identify een natuurproduct, verklaren de biosynthetische gencluster worden beschreven, met behulp polyketomycin als voorbeeld. Hier leggen we de afzonderlijke stappen die leiden uit een natuurlijk product zijn biosynthetische gencluster getoond polyketomycin geproduceerd door Streptomyces diastatochromogenes Tü6028. Het protocol omvat de identificatie en zuivering van een natuurlijk product met antibiotische eigenschappen. Verdere structurele analyse en vergelijking met resultaten van genoom mijnbouw leiden tot de identificatie van de biosynthetische gencluster. Deze procedure kan worden toegepast op elke andere verbinding afgeleid van een Streptomyces-stam of ander micro-organisme.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces-stammen zijn bekend om hun vermogen om veel verschillende verbindingen met verschillende biologische activiteiten te produceren. Kweken onder verschillende omstandigheden leidt vaak tot de productie van nieuwe verbindingen. Daarom productiekweken van de stammen geëxtraheerd met ethylacetaat en het ruwe extracten worden geanalyseerd met HPLC. Bovendien zijn de extracten getest op biologische activiteit door verschillende assays. Voor structuuropheldering de verbinding van interesse wordt gezuiverd door een combinatie van verschillende chromatografie methoden. Genome sequencing in combinatie met genoom mining maakt de identificatie van een natuurlijk product biosynthetische gencluster met behulp van verschillende computerprogramma&#39;s. Om te bevestigen dat de juiste gencluster geïdentificeerd, geninactivatie experimenten moeten worden uitgevoerd. De resulterende mutanten worden geanalyseerd op de productie van het specifieke natuurproduct. Zodra de juiste gencluster is geïnactiveerd, hetstam faalt om de verbinding te produceren. De workflow wordt getoond voor de antibacteriële verbinding polyketomycin geproduceerd door Streptomyces diastatochromogenes Tü6028. Ongeveer tien jaar geleden, toen genome sequencing was nog steeds erg duur, het klonen en de identificatie van een gen cluster was een zeer tijdrovend proces. Fast genome sequencing in combinatie met genoom mining versnelt het proces van het cluster identificatie en opent nieuwe manieren om de biosynthese te verkennen en nieuwe natuurlijke producten door genetische methoden te genereren. De in dit document beschreven protocol kan op een andere verbinding afgeleid van een Streptomyces stam of andere micro-organismen worden toegewezen.

In dit overzicht beschrijven we de afzonderlijke stappen van de identificatie van een antibioticum leidt tot de biosynthetische gencluster. Vele jaren geleden gekloneerd we een cosmide bibliotheek, verpakt ze in fagen, getransduceerd E. coli-gastheercellen en moest duizenden kolonies te screenen op de klonen met overlappende gebieden van polyketomycin cluster identificeren. Sequencing van de cosmiden was ook een moeilijk en kostbaar proces 12. Om verdere studies uit te voeren op de stam gesequenced we het hele genoom van Streptomyces diastatochromogenes Tü6028. Met het ontwerp van genoomsequentie we gemakkelijk geïdentificeerd de biosynthetische gencluster van polyketomycin en andere clusters die coderen voor veelbelovende verbindingen. Figuur 7 vergelijkt de &quot;oude&quot; methode waarmee wordt vastgesteld biosynthetische cluster door klonen van een cosmide bibliotheek en screening elaborative ende &quot;nieuwe&quot; methode whole genome sequencing met daaropvolgend genoom mining op een ruwe tijdschaal. De nieuwe sequencing technologieën en nieuwe genoom mining programma&#39;s versnellen het hele proces. <img alt="figuur 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> Figuur 7: Vergelijking van de &quot;oude&quot; en &quot;nieuwe&quot; methode van toewijzen Biosynthetisch Gene Cluster. De &quot;oude&quot; werkwijze kloneren van een cosmide bibliotheek met selectie van positieve klonen en sequentiebepaling van de respectievelijke cosmide (s) (boven); De &quot;nieuwe&quot; werkwijze whole genome sequencing en -mining alle secundaire metaboliet genenclusters op het genoom van de stam (onder) te identificeren. Duur van de afzonderlijke stappen worden weergegeven op een ruwe tijdschaal. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Klik hier om een grotere versie van deze figuur te bekijken.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

Hier presenteren we een gedetailleerd protocol van (A) de identificatie van een natuurlijk product met antibiotische werking, (B) de zuivering van de verbinding, (C), het eerste model van zijn biosynthese, (D) genome sequencing / -mining en de ( E) verificatie van de biosynthetische gencluster.

Van een natuurlijk product om Zijn Biosynthetisch Gene Cluster: Een demonstratie met behulp van Polyketomycin<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

Met een GFP-gelabeld TMEM184A Construct voor bevestiging van Heparine Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

Bereiding van de monsters en de analyse van de RNASeq gebaseerde gen expressie gegevens uit de zebravis

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Een standaard methodiek te onderzoeken ter plaatse mutageniteit als een functie van punt mutatie reparatie gekatalyseerd door CRISPR/Cas9 en SsODN in menselijke cellen

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generatie van een gen-verstoord Streptococcus mutans stam zonder Gene klonen

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficiënte productie en identificatie van CRISPR/Cas9-gegenereerd Gene uitsparingen in de modelsysteem Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Verkennen van de wortel Microbiome: extraheren van gegevens van de bacteriële Gemeenschap uit de bodem, de rhizosfeer, en de wortel Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

Informatic analyse van sequencedata van Batch gist 2-Hybrid schermen

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

High-throughput identificatie van regelgevende gensequenties met behulp van Next-generation Sequencing van circulaire chromosoom conformatie Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

In vivo toepassing van het systeem van de afstandsbediening voor de manipulatie van de endogene genexpressie

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Massa spectrometrie gebaseerde Proteomics Analyses met behulp van de OpenProt Database te onthullen nieuwe eiwitten vertaald uit niet-canonieke Open lezing Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...