Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

Dans ce laboratoire une bibliothèque de cosmide génomique de Streptomyces diastatochromogenes a été généré et projeté il y a plusieurs années, ce qui entraîne l&#39;identification du groupe de gènes polyketomycin à travers un processus extrêmement fastidieux. Caractérisation des gènes uniques sont possibles en utilisant des délétions de gènes cibles et l&#39; analyse des mutants résultant 12. Récemment, un projet de séquençage du génome de S. diastatochromogenes a été obtenue permettant l&#39;identification rapide du groupe de gènes de biosynthèse polyketomycin. Nous pourrions facilement détecter les gènes de biosynthèse, bien que le projet de séquençage du génome contient encore beaucoup de contigs. Le procédé décrit peut être réalisé en quelques mois. Cependant, le procédé comprend plusieurs étapes. étapes simples peuvent échouer à plusieurs reprises, ce qui empêche la progression vers les étapes suivantes: Le genre Streptomyces est connu pour sa capacité à produire des composés bioactifs. Alors qu&#39;ils transportent souvent plus de 20 biosclusters de gènes ynthetic, habituellement un ou deux composés sont produits dans des conditions de laboratoire. L&#39;application de l&#39;approche OSMAC (culture d&#39;une souche dans des conditions différentes) pour réveiller groupes de gènes silencieux peut parfois ne pas être suffisant. La manipulation génétique des gènes de régulation, tels que les gènes régulateurs pléiotropiques ADPA 44 et bldA 45,46, est aussi une méthode efficace pour activer la production d&#39;autres métabolites secondaires. Pour l&#39;élucidation de la structure du composé, par exemple , par analyse RMN, habituellement plus de 2 mg de composé purifié est nécessaire. Par conséquent, la fermentation de plus de 10 litres de la culture est souvent nécessaire. Sans un fermenteur qui est capable de maintenir l&#39;oxygène, du pH et de la température, il peut être difficile dans un petit laboratoire pour traiter cette quantité de la culture et l&#39;extraction ultérieure. Au cours de la purification, le composé peut être modifié en raison de l&#39;oxydation, le rayonnement ou la température.En outre, plus les étapes de purification sont utilisées, plus le risque de dégradation. Lors de l&#39;analyse de la structure du produit naturel, et les grappes dans le génome, il est parfois pas facile d&#39;identifier le cluster approprié. Tout d&#39;abord, s&#39;il y a seulement un projet de séquençage du génome une partie de la grappe peut être manquante. D&#39;autre part, tous les gènes qui sont nécessaires pour la biosynthèse ne sont pas dans le cluster. En troisième lieu, un cluster est parfois divisé en deux parties séparées l&#39;une de l&#39;autre par plusieurs kilobases. Quatrièmement, il peut être difficile de décider lequel est le groupe de gènes approprié. Dans le cas d&#39;un grand type PKS systèmes NRPS I ou, où il est possible de calculer le nombre d&#39;unités d&#39;extension en fonction du nombre de modules, ou même d&#39;identifier les unités d&#39;extension simples par analyse des domaines de la sélection, il se transforme facilement. Cependant, dans le cas d&#39;enzymes de travailler itérativement la prédiction des composés synthétisés est souvent pas possible, surtout si le straen a plus de 40 groupes de gènes. Cinquièmement, la nature est très complexe et plein de composés encore inconnus. Souvent, la biosynthèse est un mélange de différentes voies. Si le nouveau composé est pas encore identifié, ou non liés à un autre composé, il peut être difficile d&#39;identifier le cluster, de proposer un modèle de biosynthèse et pour le prouver. Une fois que le cluster est identifié, la technique de croisement unique est une bonne et rapide méthode pour vérifier l&#39;hypothèse. La PCR, le clonage dans un vecteur suicide, la conjugaison, la sélection des clones positifs, et le dosage de la production sont les seules étapes requises. Un inconvénient de cette technique est que l&#39;intégration du vecteur dans le chromosome est instable en raison d&#39;autres événements de recombinaison. Par conséquent, afin d&#39;analyser davantage les gènes individuels, des deletions de gènes précises sont nécessaires. En outre , il peut être difficile de manipuler des souches de Streptomyces sur le plan génétique. La procédure décrite peut être affectée to tout autre composé produit par une souche de Streptomyces ou d&#39; un autre micro - organisme. La connaissance d&#39;un groupe de gènes de biosynthèse et son composé synthétisé nous donne de nouvelles possibilités pour modifier déjà les molécules existantes dans le but de les améliorer pour la lutte contre les agents pathogènes multirésistantes.

Produits naturels des plantes et des micro-organismes ont toujours été une source importante pour le développement de médicaments cliniques et de recherche. Le premier Pénicilline antibiotique a été découvert en 1928 à partir d&#39; un champignon par Alexander Fleming 1. De nos jours, beaucoup plus de produits naturels sont utilisés dans le traitement clinique. Un genre connu pour sa capacité de produire divers types de métabolites secondaires avec différentes activités biologiques est Streptomyces. Streptomyces sont des bactéries Gram-positives et appartiennent à la classe des Actinobactéries et l&#39;ordre actinomycetales. Près des deux tiers des antibiotiques utilisés en clinique sont dérivés de actinomycetales, principalement à partir de Streptomyces, comme l&#39; amphotéricine 2, 3 ou daptomycine tétracycline 4. Deux prix Nobel ont été décernés dans le domaine de Streptomyces recherche sur les antibiotiques. Le premier est allé à Selman Waksman pour la découverte de la streptomycine, le premier d&#39;untibiotic efficace contre la tuberculose. 5 En 2015, dans le cadre du Prix Nobel de physiologie et de médecine, la découverte de l&#39; avermectine de S. avermitilis a été attribué aussi bien. Avermectine est utilisé pour le traitement des maladies parasitaires 6,7. L&#39;approche traditionnelle de la découverte de produits naturels tels que des micro - organismes Streptomyces implique généralement la culture de la souche dans des conditions de croissance différentes, ainsi que l&#39; extraction et l&#39; analyse des métabolites secondaires. Des essais de bioactivité (par exemple , des dosages pour l&#39; activité anti - bactérienne et anti - cancéreuse) sont réalisés pour détecter l&#39;activité du composé. Enfin, le composé d&#39;intérêt est isolée et la structure chimique est élucidée. Les structures des produits naturels sont souvent composées de fragments individuels qui se forment des molécules complexes. Il y a quelques, mais limitées, les grandes voies de biosynthèse conduisant à la construction de blocks, qui sont utilisés pour la biosynthèse des produits naturels. Les principales voies de biosynthèse sont les voies de polykétides, les voies menant à des terpénoïdes et des alcaloïdes, des voies en utilisant des acides aminés, et les voies conduisant à des fragments de sucre. Chaque voie est caractérisée par un ensemble d&#39;enzymes spécifiques 8. Sur la base de la structure du composé, ces enzymes biosynthétiques peuvent être prédites. De nos jours, l&#39;analyse structurale détaillée d&#39;un composé en combinaison avec le séquençage de la prochaine génération et l&#39;analyse bioinformatique peut aider à identifier le groupe de gènes de biosynthèse responsable. Les informations de cluster ouvre de nouvelles voies pour de nouvelles recherches sur les produits naturels. Cela comprend l&#39;expression hétérologue pour augmenter le rendement du produit naturel, la modification du composé visé par délétion du gène ou de la modification et de la biosynthèse combinatoire avec des gènes provenant d&#39;autres voies. On a isolé Polyketomycin indépendamment dans le bouillon de culture dedeux souches, Streptomyces sp. MK277 AF1 9 et 10 Tü6028 Streptomyces. La structure a été élucidée par analyse par RMN et aux rayons X. Polyketomycin se compose d&#39;un decaketid tétracyclique et un acide salicylique de diméthyle, lié par les deux fragments désoxyose ß-D-amicetose et α-L-axenose. Il affiche cytotoxique et une activité antibiotique, même contre les souches multirésistantes Gram-positives telles que le SARM 11. Une bibliothèque de cosmide génomique de S. Tü6028 a été généré et projeté il y a plusieurs années. Utilisation de gène spécifique des sondes du groupe de gènes polyketomycin avec une taille de 52,2 kb, contenant 41 gènes, a été identifié après plusieurs mois de travail intense 12. Récemment, un projet de séquençage du génome de S. diastatochromogenes a été obtenu conduisant à l&#39;identification rapide du groupe de gènes de biosynthèse polyketomycin. Dans cette vue d&#39;ensemble, une méthode aidant à identifier un produit naturel et élucider son groupe de gènes de biosynthèse sera décrit, en utilisant polyketomycin comme un exemple. Ici , nous expliquons les étapes simples qui mènent à partir d&#39; un produit naturel à son groupe de gènes de biosynthèse montré pour polyketomycin produit par Streptomyces Tü6028. Le protocole comprend l&#39;identification et la purification d&#39;un produit naturel dont les propriétés antibiotiques. En outre l&#39;analyse structurelle et la comparaison avec les résultats du génome plomb minier à l&#39;identification du groupe de gènes de biosynthèse. Cette procédure peut être appliquée à tout autre composé dérivé d&#39;une souche de Streptomyces , ou tout autre micro - organisme.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Souches de Streptomyces sont connus pour leur capacité à produire un grand nombre de composés différents avec divers bioactivité. La culture dans des conditions différentes conduit souvent à la production de nouveaux composés. Par conséquent, les cultures des souches de production sont extraites avec de l&#39;acétate d&#39;éthyle et les extraits bruts sont analysés par HPLC. En outre, les extraits sont testés quant à leur activité biologique par différents dosages. Pour la détermination de la structure du composé d&#39;intérêt est purifié par une combinaison de différentes méthodes de chromatographie. Le séquençage du génome couplé à l&#39;extraction du génome permet l&#39;identification d&#39;un groupe de gènes de biosynthèse de produits naturels en utilisant des programmes informatiques différents. Pour confirmer que le groupe de gènes correct a été identifié, des expériences d&#39;inactivation de gènes doivent être effectuées. Les mutants résultants sont analysés pour la production du produit naturel en particulier. Une fois que le groupe de gènes correct a été inactivé, lasouche devrait échouer pour produire le composé. Le flux de travail est montré pour la polyketomycin composé antibactérien produit par Streptomyces Tü6028. Il y a une dizaine d&#39;années, lorsque le séquençage du génome était encore très cher, le clonage et l&#39;identification d&#39;un groupe de gènes est un processus très chronophage. séquençage du génome rapide combiné avec l&#39;extraction du génome accélère le procès de l&#39;identification de cluster et ouvre de nouvelles façons d&#39;explorer la biosynthèse et de générer de nouveaux produits naturels par des méthodes génétiques. Le protocole décrit dans le présent document peut être attribué à un autre composé dérivé d&#39;une souche de Streptomyces ou d&#39; un autre micro - organisme.

Dans cet aperçu, nous décrivons les étapes simples de l&#39;identification d&#39;un antibiotique conduisant à son groupe de gènes de biosynthèse. Il y a plusieurs années nous avons cloné une bibliothèque de cosmides, les emballés dans des phages, transduction E. cellules hôtes coli, et a dû examiner des milliers de colonies pour identifier les clones ayant des régions qui se chevauchent de grappe polyketomycin. Le séquençage des cosmides a également été un processus difficile et coûteux 12. Afin de mener d&#39; autres études sur la souche nous avons séquencé la totalité du génome de Streptomyces Tü6028. Avec le projet de séquençage du génome nous avons facilement identifié le groupe de gènes de biosynthèse de polyketomycin et d&#39;autres groupes codant pour des composés prometteurs. La figure 7 compare la méthode &quot;ancienne&quot; pour identifier le cluster de biosynthèse par clonage d&#39;une banque de cosmides et de dépistage élaboratif etla «nouvelle» méthode par séquençage du génome entier à l&#39;exploitation du génome ultérieur sur une échelle de temps rugueux. Les nouvelles technologies de séquençage et de nouveaux programmes d&#39;exploration de génome d&#39;accélérer l&#39;ensemble du processus. <img alt="Figure 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> Figure 7: Comparaison de la «vieille» et «nouvelle» méthode d&#39;attribution d&#39; un gène biosynthétique Cluster. La méthode &quot;ancienne&quot; comprend le clonage d&#39;une banque de cosmides avec la sélection des clones positifs et le séquençage du cosmide (s) respectif (ci-dessus); La méthode «nouvelle» comprend le séquençage du génome entier et -mining pour identifier tous les groupes de gènes de métabolites secondaires situés sur le génome de la souche (ci-dessous). Durée des étapes simples sont présentées sur une échelle de temps rugueux. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">S&#39;il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

Nous présentons ici un protocole détaillé de (A) l&#39;identification d&#39;un produit naturel avec une activité antibiotique, (B) la purification du composé, (C) le premier modèle de sa biosynthèse, (D) le séquençage du génome / -mining et ( E) la vérification du groupe de gènes de biosynthèse.

D&#39;un produit naturel à son cluster Gène biosynthétique: Une démonstration utilisant Polyketomycin de<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

L&#39;utilisation d&#39;un TMEM184A GFP-tagged Construct pour Confirmation de Heparin Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Recherche

Génétique

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

Préparation des échantillons et l’analyse des données sur l’Expression génique à base RNASeq de poisson-zèbre

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Une méthode Standard pour examiner la mutagénicité sur place en fonction de la Mutation ponctuelle de réparation catalysée par CRISPR/Cas9 et SsODN dans les cellules humaines

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Génération d’un gène-perturbé Streptococcus mutans souche sans gène clonage

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Une Production efficace et généré par l’Identification de CRISPR/Cas9 les débouchures de gène dans le modèle système Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Explorant le Microbiome racine : extraire les données de la communauté bactérienne du sol, rhizosphère et racine endosphère

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

Analyse informatique des données de séquence d’écrans de 2-hybride de levure lot

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

High-throughput Identification des séquences régulatrices du gène à l’aide de prochaine génération séquençage du Chromosome circulaire Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Application in vivo de la système de télécommande pour la Manipulation d’Expression des gènes endogènes

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Basé sur la spectrométrie de masse protéomique des Analyses à l’aide de la base de données OpenProt de dévoiler de nouvelles protéines traduit de cadres ouverts de lecture Non canoniques

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...