Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

In diesem Labor wurde eine genomische Cosmid - Bibliothek von Streptomyces diastatochromogenes erzeugt und abgeschirmt vor vielen Jahren, was zur Identifizierung des polyketomycin Gencluster durch ein extrem zeitaufwändiger Prozess. Charakterisierung einzelner Gene möglich waren Zielgen Deletionen unter Verwendung und Analyse der resultierenden Mutanten 12. Vor kurzem wurde ein Entwurf Genomsequenz von S. diastatochromogenes erhalten die schnelle Identifizierung des polyketomycin Biosynthesegenclusters ermöglicht. Wir könnten die Biosynthesegene leicht erkennen, obwohl der Entwurf Genomsequenz noch viele contigs enthält. Das beschriebene Verfahren kann innerhalb von Monaten erreicht werden. Jedoch umfaßt das Verfahren viele Schritte. Einzelne Schritte können mehrmals fehlschlagen, das Fortschreiten zu den nachfolgenden Schritten zu verhindern: Die Gattung Streptomyces ist bekannt für seine Fähigkeit bioaktiven Verbindungen herzustellen. Während sie tragen oft mehr als 20 BIOSynthetic Gencluster, in der Regel nur eine oder zwei Verbindungen, die unter Laborbedingungen hergestellt werden. Die Anwendung des OSMAC Ansatz (Kultivierung eines Stamms unter verschiedenen Bedingungen) stillen Gencluster aufwachen kann manchmal nicht genug sein. Genetische Manipulation von regulatorischen Genen, wie beispielsweise die pleiotrope Regulatorgene ADPA 44 und BLDA 45,46, ist auch eine wirksame Methode , um die Produktion von anderen Sekundärmetaboliten zu aktivieren. Für die Aufklärung der Struktur der Verbindung, beispielsweise durch NMR - Analyse, in der Regel mehr als 2 mg gereinigte Verbindung notwendig ist . Daher Fermentation von mehr als 10 L-Kultur ist oft erforderlich. Ohne einen Fermenter, die Sauerstoff, pH und Temperaturbedingungen in der Lage zu halten, kann es in einem kleinen Labor schwierig sein, diese Menge an Kultur und anschließende Extraktion zu handhaben. Während der Reinigung kann die Verbindung aufgrund von Oxidation, Strahlung oder Temperatur verändert.Auch sind die mehreren Reinigungsschritten, desto höher ist die Wahrscheinlichkeit der Verschlechterung verwendet. Wenn die Struktur des Naturstoffs zu untersuchen und die Cluster im Genom, manchmal ist es nicht so einfach, die entsprechenden Cluster zu identifizieren. Erstens, wenn es nur einen Entwurf Genomsequenz ein Teil des Clusters möglicherweise fehlt ist. Zweitens sind nicht alle Gene, die für die Biosynthese erforderlich sind, sind in dem Cluster. Drittens wird manchmal ein Cluster in zwei Teile voneinander von vielen Kilobasen getrennt gespalten. Viertens kann es schwierig sein, zu entscheiden, welches das entsprechende Gen-Cluster ist. Bei großen PKS vom Typ I oder NRPS-Systemen, wo es möglich ist, die Anzahl der Verlängerungseinheiten basierend auf der Anzahl von Modulen oder sogar identifizieren die einzelnen Verlängerungseinheiten durch Analyse der Auswahl Domänen zu berechnen, stellt sich leicht auf. Jedoch im Fall der iterativ arbeitEnzymen die Vorhersage der synthetisierten Verbindungen oft nicht möglich ist, insbesondere wenn die Strain mehr als 40 Gencluster. Fünftens ist die Natur sehr komplex und voller noch unbekannte Verbindungen. Oft ist die Biosynthese ist eine Mischung von verschiedenen Wegen. Wenn die neue Verbindung noch nicht identifiziert worden ist, oder nicht in eine andere Verbindung im Zusammenhang, kann es schwierig sein, den Cluster zu identifizieren, eine Biosynthese Modell vorzuschlagen, und um es zu beweisen. Sobald der Cluster identifiziert wird, ist die einzige Crossover-Technik eine gute und schnelle Methode, um die Hypothese zu überprüfen. PCR, Klonierung in einen Suizidvektor, Konjugation, Auswahl von positiven Klonen und die Produktion Test sind die einzigen Schritte erforderlich. Ein Nachteil dieser Technik ist, dass die Integration des Vektors in das Chromosom nicht stabil ist durch weitere Rekombinationsereignisse. Deshalb, um einzelne Gene, präzise Gendeletionen weiter zu analysieren sind erforderlich. Auch kann es schwierig sein , Streptomyces - Stämmen auf der genetischen Ebene zu manipulieren. Die beschriebene Vorgehensweise kann t zugeordnet werdeno andere Verbindung , die durch einen Streptomyces - Stamm oder einem anderen Mikroorganismus hergestellt. Das Wissen über ein Gencluster und seine synthetisierte Verbindung gibt uns weitere Möglichkeiten zu modifizieren bereits bestehenden Moleküle mit dem Ziel, sie für den Kampf gegen multiresistente Erreger zu verbessern.

Natürliche Produkte aus Pflanzen und Mikroorganismen haben immer eine wichtige Quelle für die klinische Entwicklung von Arzneimitteln und Forschung. Das erste Antibiotikum Penicillin wurde 1928 von einem Pilz von Alexander Fleming 1 entdeckt. Heutzutage sind viele natürliche Produkte in der klinischen Behandlung eingesetzt. Eine Gattung bekannt für ihre Fähigkeit , verschiedene Arten von sekundären Metaboliten mit verschiedenen biologischen Aktivitäten herzustellen , ist Streptomyces. Streptomyces sind grampositive Bakterien und gehören zu der Klasse von Actinobacteria und der Ordnung Actinomycetales. Fast zwei Drittel der klinisch verwendeten Antibiotika sind aus Actinomycetales abgeleitet, vor allem aus Streptomyces, wie Amphotericin 2, Daptomycin 3 oder Tetracyclin 4. Zwei Nobelpreise wurden auf dem Gebiet der Streptomyces Antibiotikaforschung ausgezeichnet. Der erste ging an Selman Waksman für die Entdeckung von Streptomycin, wobei die erste einetibiotic wirksam gegen Tuberkulose. 5 Im Jahr 2015 als Teil des Nobelpreis für Physiologie und Medizin, die Entdeckung von Avermectin von S. avermitilis wurde ebenfalls ausgezeichnet. Avermectin wird zur Behandlung von parasitären Erkrankungen 6,7 verwendet. Der traditionelle Ansatz für die Entdeckung von Naturprodukten in Mikroorganismen wie Streptomyces umfaßt im allgemeinen Kultivierung des Stammes unter verschiedenen Wachstumsbedingungen, sowie die Extraktion und Analyse von Sekundärmetaboliten. Bioaktivität Assays (beispielsweise Tests für antibakterielle und Anti - Krebs - Aktivität) werden durchgeführt , um die Aktivität der Verbindung zu erfassen. Schließlich wird die Verbindung von Interesse isoliert, und die chemische Struktur aufgeklärt wird. Die Strukturen von Naturprodukten sind oft aus einzelnen Einheiten zusammengesetzt, die komplexe Moleküle bilden. Es gibt ein paar, aber begrenzt, großen Biosynthesewege zu führenden Blockbildungks, die für die Biosynthese von Naturprodukten verwendet werden. Die wichtigsten Biosynthesewege sind die Polyketid-Bahnen, Bahnen, die zu Terpenoide und Alkaloide, Wege Aminosäuren verwendet und Wege zu Zuckergruppen führen. Jeder Weg wird durch einen Satz von spezifischen Enzymen 8 gekennzeichnet. Auf der Basis der Struktur der Verbindung können diese biosynthetischen Enzyme vorhergesagt werden. Heute kann die detaillierte Strukturanalyse einer Verbindung in Kombination mit der nächsten Generation Sequenzierung und bioinformatischen Analyse helfen den verantwortlichen Biosynthesegenclusters zu identifizieren. Die Cluster-Informationen eröffnet neue Wege für die weitere Naturstoffforschung auf. Dazu gehören die heterologe Expression die Ausbeute des Naturprodukt, gezielte Verbindung Modifikation durch Gen-Deletion oder Veränderung und kombinatorische Biosynthese mit Genen von anderen Bahnen zu erhöhen. Polyketomycin wurde unabhängig von der Kulturbrühe isoliertzwei Stämme, Streptomyces sp. MK277-AF1 9 und Streptomyces diastatochromogenes Tü6028 10. Die Struktur wurde durch NMR und Röntgenstrukturanalyse aufgeklärt. Polyketomycin besteht aus einem tetracyclischen decaketid und einem dimethyl Salicylsäure, verbunden durch die beiden Desoxyzucker Einheiten β-D-amicetose und α-L-axenose. Es zeigt zytotoxische und antibiotische Aktivität, auch gegen Gram-positive multidrug-resistente Stämme wie MRSA 11. Eine genomische Cosmid - Bibliothek von S. diastatochromogenes Tü6028 erzeugt wurde und vor vielen Jahren untersucht. Mit Hilfe spezifischer Gensonden die polyketomycin Gencluster mit einer Größe von 52,2 kb, enthält 41 Gene wurden 12 nach mehreren Monaten intensiver Arbeit identifiziert. Vor kurzem wurde ein Entwurf Genomsequenz von S. diastatochromogenes erhalten die schnelle Identifizierung des polyketomycin Gencluster führt. In dieser Übersicht hilft ein Verfahren zu identifizieren ein natürliches Produkt und verdeutlichen seine Biosynthesegenclusters beschrieben werden, als Beispiel polyketomycin. Hier erläutern wir die einzelnen Schritte , die von einem natürlichen Produkt seiner Biosynthesegenclusters für polyketomycin hergestellt gezeigt führen durch Streptomyces diastatochromogenes Tü6028. Das Protokoll umfasst die Identifizierung und Reinigung eines Naturprodukt mit antibiotischen Eigenschaften. Weitere strukturelle Analyse und den Vergleich mit den Ergebnissen aus Genom-Mining führen zur Identifizierung des Biosynthesegenclusters. Dieses Verfahren kann aus einem Streptomyces - Stamm oder einem anderen Mikroorganismus abgeleitet jede andere Verbindung angewendet werden.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces - Stämme sind für ihre Fähigkeit bekannt , eine Menge von verschiedenen Verbindungen mit verschiedenen biologischen Aktivitäten herzustellen. Kultivierung unter verschiedenen Bedingungen führt oft zur Herstellung neuer Verbindungen. Daher Produktionskulturen der Stämme werden mit Ethylacetat extrahiert, und die Rohextrakte durch HPLC analysiert. Weiterhin werden die Extrakte für die Bioaktivität von verschiedenen Assays getestet. Für die Strukturaufklärung der Verbindung von Interesse wird durch eine Kombination verschiedener Chromatographie-Verfahren gereinigt. Die Sequenzierung des Genoms gekoppelt mit Genomanalyse ermöglicht die Identifizierung von einem natürlichen Produkt Biosynthesegenclusters verschiedene Computerprogramme verwendete. Um zu bestätigen, dass das richtige Gen-Cluster identifiziert wurde, Gen-Inaktivierung Experimente durchgeführt werden müssen. Die resultierenden Mutanten sind für die Produktion der jeweiligen Naturprodukt analysiert. Sobald die richtige Gencluster inaktiviert wurde, dieStamm ausfallen sollte, die Verbindung herzustellen. Der Workflow wird für die antibakterielle Verbindung polyketomycin von Streptomyces diastatochromogenes Tü6028 produziert gezeigt. Vor rund zehn Jahren, als der Genomsequenzierung noch sehr teuer war, das Klonen und die Identifizierung eines Gens Cluster war ein sehr zeitaufwändiger Prozess. Schnelle Genomsequenzierung mit Genomanalyse kombiniert beschleunigt die Studie der Cluster Identifizierung und neue Wege eröffnet, um die Biosynthese erforschen und neue natürliche Produkte durch genetische Methoden zu erzeugen. Das Protokoll in diesem Dokument beschrieben sind, können aus einem Streptomyces - Stamm oder einem anderen Mikroorganismus abgeleitet jede andere Verbindung zugeordnet werden.

In dieser Übersicht beschreiben wir die einzelnen Schritte von der Identifizierung eines Antibiotikums zu seinem Biosynthesegenclusters führt. Vor vielen Jahren wir eine Cosmid - Bibliothek geklont, um sie in Phagen verpackt transduzierten Wirtszellen E. coli, und hatte tausende von Kolonien zu screenen , um die Klone zu identifizieren , mit überlappenden Regionen polyketomycin Cluster. Sequenzierung der Cosmide wurde auch ein schwieriger und teurer Prozess 12. Um weitere Studien zur Belastung zu führen sequenziert wir das gesamte Genom von Streptomyces diastatochromogenes Tü6028. Mit dem Entwurf des Genomsequenz leicht identifiziert wir das Gencluster von polyketomycin und anderen Clustern kodieren, viel versprechende Verbindungen. 7 vergleicht die &quot;alte&quot; Methode der Biosynthese - Cluster durch Klonierung einer Cosmid - Bibliothek und elaborative Screening identifiziert unddie &quot;neue&quot; Verfahren durch Sequenzierung ganzer Genome mit anschließender Genom-Mining auf einer rauhen Zeitskala. Die neuen Sequenzierungstechnologien und neue Genom-Mining-Programme beschleunigen den gesamten Prozess. <img alt="7" src="/files/ftp_upload/54952/54952fig7.jpg" /> Abbildung 7: Vergleich der &quot;alten&quot; und &quot;neuen&quot; Verfahren zur Herstellung eines Biosynthesegenclusters zuordnen. Die &quot;alte&quot; Verfahren umfasst Klonierung einer Cosmid-Bibliothek mit der Auswahl von positiven Klonen und Sequenzieren des entsprechenden Cosmids (n) (oben); Die &quot;neue&quot; Verfahren umfasst gesamte Genomsequenzierung und -mining alle sekundären Metaboliten Genclustern auf dem Genom des Stammes (unten) gelegen zu identifizieren. Dauer der einzelnen Schritte werden auf einer groben Zeitskala gezeigt. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

Hier präsentieren wir ein detailliertes Protokoll von (A) die Identifizierung eines Naturprodukt mit antibiotische Aktivität, (B) die Reinigung der Verbindung, (C) das erste Modell seiner Biosynthese, (D) Genomsequenzierung / -mining und die ( E) die Überprüfung der Biosynthesegenclusters.

Von einem natürlichen Produkt in seine Biosynthesegenclusters: Eine Demonstration Mit Polyketomycin aus<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

ein GFP-markierten TMEM184A Verwendung für die Bestätigung der Heparin-Rezeptor Identität Construct

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Forschung

Genetik

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

Probenvorbereitung und Analyse der RNASeq-basierte Genexpressionsdaten von Zebrafisch

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Eine Standardmethodik, vor-Ort-Mutagenität als Funktion der Punktmutation Reparatur katalysiert durch CRISPR/Cas9 und SsODN in den menschlichen Zellen zu untersuchen

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation von einem Gen gestört Streptococcus Mutans Belastung ohne Gene Klonen

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Effiziente Produktion und Kennzeichnung der CRISPR/Cas9 generiert gen Knockouts im Modellsystem Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Die Wurzel Mikrobiom zu erkunden: Extrahieren von Bakteriengemeinschaft Daten aus dem Boden, die Rhizosphäre und die Wurzel Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

Informatischen Analyse von Sequenzdaten von Batch-Hefe-2-Hybrid-Bildschirme

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Hochdurchsatz-Identifizierung des Gens regulatorischen Sequenzen mit Next-Generation Sequenzierung der kreisförmigen Chromosom Konformation erfassen (4C-Seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

In-vivo Anwendung der REMOTE-Steuerung für die Manipulation von endogenen Genexpression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Massenspektrometrie-basierte Proteomics Analysen mithilfe der OpenProt-Datenbank zu enthüllen neue Proteine übersetzt aus dem nicht-kanonischen Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...